Pyurf (NM_025574) Mouse Untagged Clone
CAT#: MC202444
Pyurf (untagged) - Mouse phosphatidylinositol glycan anchor biosynthesis, class Y (Pigy), nuclear gene encoding mitochondrial protein, (10ug)
CNY 2000.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 2610022G08Rik; AI847956; Prey |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC029232 sequence for NM_025574
CGGACGCGTGGGTCGGACGCGTGGGTTCTGAGCCGCCATGCTGAGCGCCACGTGCCGCAGGCTCGCCCCG GCGCTGCGGAGGCTCCGCGCACTGTCTGCAGTCGCCGGGAGGTTTCTGCAAGTGCCCGGGGCCAGGCTCT GCTCTGACCAGAGCGAGAGGGCTGAGCAGCCCCACACCTTCCACCCGGCGCTGCTGCAGTTCCTGGTGTG TCCGCTCTCCAAGAAGCCGCTTAGATATGAAGCATCGACAAATGAATTGGTTAATGAAGAGTTGGGAATA GCATATCCAATCATTGATGGGATCCCTAATATGATACCACAGGCAGCAAGGACCACACGTCAAAATGAGA AGCAAGAAGAAGCTGAGCAACCCTAGACCCTGATTGTTAAAAGCATAATTACTGAGTTCTCTTAATTCTG TACACCTTTAACACAGGGAGGGAGAGTTGGGGTGGAACAGTAATTCTGCCTCGGCCTGCTTGACTGTTCT TCCCCTGCCCTCTTTAGCAGGACTATTCTGATCTGCTTTTCTGGAGGAGAATGTCCCACAGGGCTGCACC AGCACAGACCACAGACAGGCTTTGACTTTACAGTGTGCTTTTGCCAACCACCATAGCAATGTGTGTGTTC TCCCACCTTTGGAACCAGAAAGGTCTAAAACTCTTTAAGTGTAGTTAGTACAACCATAGCCGGGACAGCA CGTGGATTAATAAGAGATCTGCAGCAACATCTGTGAAAACTACATATAAACCCATTTGATTTATAAAAAA AAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_025574 |
Insert Size | 339 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC029232, AAH29232 |
RefSeq Size | 779 bp |
RefSeq ORF | 339 bp |
Locus ID | 66459 |
UniProt ID | Q9D1C3 |
Gene Summary | This gene encodes a small protein with a conserved DUF343 domain. The human ortholog of this gene expresses two distinct proteins from upstream and downstream coding regions. The upstream CDS encoding a DUF343 domain-containing protein has been conserved at this mouse locus, but the downstream CDS encoding a subunit of an enzyme involved in glycosylphosphatidylinositol biosynthesis has not been conserved. Instead, a separate locus on mouse chromosome 9 encodes the mouse homolog of the human phosphatidylinositol glycan anchor biosynthesis, class Y protein. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG200443 | Pyurf (tGFP-tagged) - Mouse phosphatidylinositol glycan anchor biosynthesis, class Y (Pigy) |
CNY 2850.00 |
|
MR200443 | Pyurf (Myc-DDK-tagged) - Mouse phosphatidylinositol glycan anchor biosynthesis, class Y (Pigy), nuclear gene encoding mitochondrial protein |
CNY 1200.00 |
|
MR200443L3 | Lenti ORF clone of Pyurf (Myc-DDK-tagged) - Mouse phosphatidylinositol glycan anchor biosynthesis, class Y (Pigy), nuclear gene encoding mitochondrial protein |
CNY 4750.00 |
|
MR200443L4 | Lenti ORF clone of Pyurf (mGFP-tagged) - Mouse phosphatidylinositol glycan anchor biosynthesis, class Y (Pigy), nuclear gene encoding mitochondrial protein |
CNY 4750.00 |