Cldn5 (NM_013805) Mouse Untagged Clone
CAT#: MC202457
Cldn5 (untagged) - Mouse claudin 5 (Cldn5), (10ug)
CNY 3600.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | AI854493; MBEC1; Tmvc; Tmvcf |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC083341 sequence for NM_013805
GTTAAAACCTCCTCTTCTGCTCCAGGACTGGAGGCTCCAGAGCAGAGGCACCAGAATCAATTCCCAGCTC CCAGCCTAAGCAGCGCAGAGAGCACCCGGAGGCCCCAAGGGCCGTCGGGTGAGCATTCAGTCTTTAGCCA TGGGGTCTGCAGCGTTGGAAATTCTGGGTCTGGTGCTGTGTCTGGTAGGATGGGTGGGCTTGATCCTGGC GTGTGGGCTGCCCATGTGGCAGGTGACTGCCTTCCTGGACCACAACATCGTGACGGCGCAGACGACTTGG AAGGGGCTGTGGATGTCGTGCGTGGTGCAGAGTACCGGGCACATGCAGTGCAAGGTGTATGAATCTGTGC TGGCGCTGAGTGCGGAGGTGCAGGCAGCTCGGGCACTCACCGTGGGCGCTGTGCTGCTGGCGCTGGTGGC ACTCTTTGTTACCTTGACCGGCGCTCAGTGCACCACCTGCGTGGCCCCGGGCCCAGTTAAGGCACGGGTA GCACTCACGGGAGGAGCGCTTTACGCGGTGTGCGGGCTGCTGGCACTCGTGCCGCTCTGCTGGTTCGCCA ACATCGTTGTCCGCGAGTTCTATGATCCGACGGTGCCGGTGTCACAGAAGTACGAGCTGGGCGCGGCGCT GTACATCGGCTGGGCGGCCTCCGCACTGCTCATGTGCGGTGGCGGCCTCGTGTGTTGCGGCGCCTGGGTC TGCACCGGGCGCCCTGAGTTCAGCTTCCCGGTCAAGTACTCTGCGCCGCGGCGGCCCACGGCCAATGGCG ATTACGACAAGAAGAACTATGTCTAAGGGCGGGAGGCATGGCGGGGCTCTTCCCGCAGCTAAGCCCGCGA TGGGAAAGACCGATGCGGGAAGCCGTGTGTGGATGACGACCACCGCTGGGTTGCGCAGCGCAAGTCATGC TGGGTTCGGGCCAGACTTGCCCGCTCTCAGAGTCCGTTGACCATCACTAGCCGGGCCCTGCTCAGAACAG ACTACAGGCACTTTTAAGAACTTGACCGACCTTTTCTTCTATGCGCAGTTGGCCACGACGTGGGTGGAAC GCTCAGATTTCATCGGTGAAGTAGGCACCAAACTGCCGCGAACAGTTCCTACTGAGATCCTGGGGGCACT AGATGCTGCCTTAATGTCCAGTGGCACCTGCTAACCTGAAAGGGCAGCTGGAGAAACCCCGGGGCTGCCA GAGGGACGTGTTAAAAAGGGCATTTTCTTTGTTAGTGGAGAAGAACCTACTGAACCAAAGGACTTAGCCT GGACCTGGTCTCACTCCAGCACTCCCCCAAGGTGGGGGCCCTGTAGGTACCAGAGCCTTAGAGGGGTTGC CTTCCTCCTGGAAGCTTGGGGCTTGGGGGGTGGGCCGGGCAAGAATTTGCTCAGTAAATGGTTTGAACAC TTTAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | AscI-NotI |
ACCN | NM_013805 |
Insert Size | 657 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC083341, AAH83341 |
RefSeq Size | 1428 bp |
RefSeq ORF | 657 bp |
Locus ID | 12741 |
UniProt ID | O54942 |
Gene Summary | This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. The protein encoded by this gene is a critical component of endothelial tight junctions that control pericellular permeability. The knockout mice lacking this gene died within 10 h of birth and the blood-brain barrier in these mice against small molecules was selectively affected. This gene is expressed strongly in endothelium of normal lung and plays a regulation role during acrolein-induced acute lung injury. [provided by RefSeq, Aug 2010] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG202442 | Cldn5 (tGFP-tagged) - Mouse claudin 5 (Cldn5) |
CNY 5200.00 |
|
MR202442 | Cldn5 (Myc-DDK-tagged) - Mouse claudin 5 (Cldn5) |
CNY 3600.00 |
|
MR202442L1 | Lenti ORF clone of Cldn5 (Myc-DDK-tagged) - Mouse claudin 5 (Cldn5) |
CNY 5890.00 |
|
MR202442L2 | Lenti ORF clone of Cldn5 (mGFP-tagged) - Mouse claudin 5 (Cldn5) |
CNY 6000.00 |
|
MR202442L3 | Lenti ORF clone of Cldn5 (Myc-DDK-tagged) - Mouse claudin 5 (Cldn5) |
CNY 5890.00 |
|
MR202442L4 | Lenti ORF clone of Cldn5 (mGFP-tagged) - Mouse claudin 5 (Cldn5) |
CNY 6000.00 |