Aip (NM_016666) Mouse Untagged Clone

CAT#: MC202516

Aip (untagged) - Mouse aryl-hydrocarbon receptor-interacting protein (Aip), (10ug)



  "NM_016666" in other vectors (4)

CNY 2400.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (4)
AIP Antibody - middle region
    • 50 ug

CNY 4628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms A; AA408703; Ara9; AW476050; D19Bwg1412e; Fkbp1; Fkbp16; Xa; Xap2
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC075614 sequence for NM_016666
CGGGGAAGGAGGATGGCGGATCTCATCGCAAGACTTCGAGAGGACGGGATCCAAAAGCGTGTGATACAGG AGGGCCGAGGAGAGTTGCCGGACTTTCAGGATGGCACTAAGGCCACGTTCCACTTTCGGACGCTGCACAG TGACAATGAAGGCTCCGTTATAGATGACAGCCGAACACGAGGCAAGCCCATGGAGCTCATCGTTGGCAAG AAGTTCAAGTTGCCTGTGTGGGAGACCATCGTGTGCACCATGCGTGAGGGGGAGATTGCCCAGTTCCTCT GTGACATCAAGCACGTAGTCCTGTATCCTCTAGTGGCCAAGAGCCTCCGCAACATCGCCGAGGGCAAGGA CCCCCTGGAGGGACAGCGGCATTGCTGTGGGATCGCTCAGATGCATGAACACAGCTCCCTGGGTCATGCG GACCTGGATGCCCTGCAGCAGAACCCACAGCCTCTCATCTTCCACATCGAGATGCTGAAGGTAGAGAGTC CTGGCACCTATCAACAGGACCCATGGGCGATGACAGATGAGGAGAAAGCAAAGGCAGTACCAGTCATCCA CCAAGAGGGCAACCGGTTGTACCGTGAGGGCCAGGTGAAAGAGGCTGCTGCCAAGTACTATGACGCCATC GCCTGCCTCAAGAATCTGCAGATGAAGGAGCAGCCTGGCTCACCTGACTGGATCCAGTTGGACCTGCAGA TCACACCACTGCTACTCAACTATTGCCAGTGCAAGCTGGTGGCTCAGGAGTATTATGAAGTGTTGGATCA CTGCTCCTCCATCCTCAACAAGTATGATGACAATGTCAAGGCTTACTTCAAGAGGGGTAAGGCCCATGCT GCCGTGTGGAATGCCCAGGAGGCCCAGGCTGACTTTGCCAAGGTGTTGGAGCTAGACCCTGCCCTGGCGC CTGTGGTAAGCAGAGAGCTGCGGGCCCTGGAGACACGGATCCGGCAGAAGGATGAGGAGGACAAAGCTCG CTTCCGGGGCATCTTTTCCCACTGACAGGGCCCCAGTTCTGCCCTGCCTTGCCATGCCCTGCCCTGCCCT GCCAAGCCCACTGCTGCCACCACCTGTCAATCCCCCACTGTCACTTTGCGCTTCTGTGTATATAAAGGCC TTATTTATCAAAAAAAAAAAAAAAAAA
Restriction Sites AscI-NotI     
ACCN NM_016666
Insert Size 993 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC075614, AAH75614
RefSeq Size 1147 bp
RefSeq ORF 993 bp
Locus ID 11632
UniProt ID O08915
Gene Summary This gene encodes an Hsp90-associated protein that is localized to the cytoplasm. The encoded protein interacts with the aryl hydrocarbon receptor (AhR) and the tyrosine kinase receptor RET, inhibits AhR ubiquitination, and regulates the intracellular localization of AhR. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
Transcript Variant: This variant (1) represents the longer transcript. Both variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript from the same strain was available for the full length of the gene. The extent of this transcript is supported by transcript alignments and orthologous data.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...