Ntmt1 (NM_170592) Mouse Untagged Clone
CAT#: MC202863
Ntmt1 (untagged) - Mouse methyltransferase like 11A (Mettl11a), (10ug)
CNY 2400.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 2610205E22Rik; AL033331; AL033332; Mettl11a; NTM1A |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC027220 sequence for NM_170592
GAGGTGTCTGGTCCGGTAGAGTGGTGGCGGCTGCTGTGGGCTACGGTCTTTGCCAGCCTCCTTCTCAACC CGTCCTTTTCTCTCGGGTCCCTGGAGCCCCGACCCAGGGGAGCAGCGAGGTGGCTGGCGACTTCACGGCT GGTGACGTCATGACGAGCGAGGTGATTGAGGATGAGAAACAGTTTTATTCGAAGGCCAAGACCTACTGGA AGCAGATCCCACCCACGGTGGACGGCATGCTCGGGGGGTATGGCCACATCTCCAACATCGACCTCAACAG CTCCCGGAAGTTTCTACAGAGGTTTTTAAGGGAAGGCCCAAACAAGACAGGGACTTCCTGTGCCTTGGAC TGTGGCGCTGGTATTGGAAGGATCACCAAGCGCCTGCTCCTGCCACTCTTCAGGGTGGTCGACATGGTCG ACGTGACAGAAGACTTTCTGGCCAAAGCCAAGACCTACCTGGGGGAAGAGGGCAAGAGGGTGAGGAACTA CTTCTGCTGTGGGCTGCAGGACTTCAGCCCTGAGCCTGGCTCCTATGACGTGATCTGGATCCAGTGGGTG ATAGGCCACCTGACGGATCAGCACCTGGCTGAGTTTCTGCGCCGCTGCAAGCGGGGCCTGCGCCCCAATG GCATCATCGTCATCAAGGACAACATGGCCCAGGAGGGTGTGATCCTGGACGATGTGGACAGCAGTGTGTG CCGGGACCTTGAGGTGGTCCGCCGGATCATCCGCACTGCAGGCCTCAGCCTCCTGGCCGAGGAGCGCCAG GAGAACCTGCCAGATGAGATCTACCATGTCTACAGCTTTGCCCTGAGATGAAGCCAGGGCCAGAGCTGGG GGCCAGCAGCTGGCAGGCCAAGAGACACACCATTGACTCCAGTGGGAAGGGTCAAGCCCTAGGGGAGGTG TGCCCTGGATTGGGGCACTGCAGCCCTGTCACTCTAAAGCACCCTGGCAGCTTCCCACAGGGCTATGGAA AGCAGAGTTGGTCACCGCTGGTCTAGCTGCCCAAGGAGAAAGACTTCACTTGGTTGCCTAGGGACCTCAA TGTGTGGACTGCTGTGTTCCAGGACAGCCAGGCCACACATGGTACCTGCCAGACAGTACCAATTACAGAA ATGGTCACAGCCCCATATCCTCTTTGGTGATGGGTCACAGCAGCCTGCAGCTCCTAGGAGCTCCTCTCTG ACACAGCCAATAAAAGGGTGAGTCCTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | RsrII-NotI |
| ACCN | NM_170592 |
| Insert Size | 672 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC027220, AAH27220 |
| RefSeq Size | 1251 bp |
| RefSeq ORF | 672 bp |
| Locus ID | 66617 |
| UniProt ID | Q8R2U4 |
| Gene Summary | Distributive alpha-N-methyltransferase that methylates the N-terminus of target proteins containing the N-terminal motif [Ala/Gly/Pro/Ser]-Pro-Lys when the initiator Met is cleaved. Specifically catalyzes mono-, di- or tri-methylation of the exposed alpha-amino group of the Ala, Gly or Ser residue in the [Ala/Gly/Ser]-Pro-Lys motif and mono- or di-methylation of Pro in the Pro-Pro-Lys motif (PubMed:20668449). Some of the substrates may be primed by METTL11B-mediated monomethylation. Catalyzes the trimethylation of the N-terminal Gly in CENPA (after removal of Met-1) (By similarity). Responsible for the N-terminal methylation of KLHL31, MYL2, MYL3, RB1, RCC1, RPL23A and SET. Required during mitosis for normal bipolar spindle formation and chromosome segregation via its action on RCC1 (PubMed:20668449).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) encodes the longest isoform (a). Variants 1 and 2 both encode the same isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG202578 | Ntmt1 (tGFP-tagged) - Mouse RIKEN cDNA 2610205E22 gene (2610205E22Rik) |
CNY 2850.00 |
|
| MR202578 | Ntmt1 (Myc-DDK-tagged) - Mouse methyltransferase like 11A (Mettl11a) |
CNY 2400.00 |
|
| MR202578L3 | Lenti ORF clone of Ntmt1 (Myc-DDK-tagged) - Mouse methyltransferase like 11A (Mettl11a) |
CNY 4750.00 |
|
| MR202578L4 | Lenti ORF clone of Ntmt1 (mGFP-tagged) - Mouse methyltransferase like 11A (Mettl11a) |
CNY 4750.00 |
