Kng1 (NM_023125) Mouse Untagged Clone

CAT#: MC202872

Kng1 (untagged) - Mouse kininogen 1 (Kng1), transcript variant 2, (10ug)



  "NM_023125" in other vectors (4)

CNY 2000.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms Kng
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC018158 sequence for NM_023125
GAGAGATCAGAGCCCAGAGGCTGCCAAAATCAGCTTCTGAGTTGGTTTCCCATTCTTGGCAAAACAGTCC CTCAGTTCTAGAGGGACCCTTAAATCATGAAGCTCATTACTACACTGCTCCTCTGCTCCGGACTCCTGCT GACTTTAACACAGGGAGAAGAAGCGCAGGAAATTGACTGCAATGATGAGGCTGTATTTCAGGCTGTGGAT TTCTCTCTGAAGCAGTTTAACCCTGGGGTAAAAAGTGGCAACCAGTATATGTTGCACCGAGTGATCGAGG GCACTAAAACGGATGGCTCTCCAACCTTTTACTCCTTCAAGTATCTAATCAAGGAGGGCAACTGCTCTGC TCAGAGTGGCCTCGCATGGCAGGACTGTGACTTCAAGGACGCTGAGGAAGCCGCCACTGGAGAATGCACA GCAACTGTGGGGAAAAGAGAAAATGAATTCTTCATAGTCACCCAGACCTGCAAGATTGCTCCAAGTAAGG CCCCCATACTGAAAGCCTATTTCCCCTGTATTGGTTGTGTGCATGCCATATCGACAGATAGTCCAGACCT GGAGCCTGTTCTGAAACACTCCATCGAACATTTCAACAACAACACAGATCACAGCCACCTCTTTACTCTC AGAAAAGTAAAAAGTGCCCACAGACAGGTGGTGGCTGGCCTGAATTTTGACATTACCTACACAATTGTGC AAACAAATTGTTCAAAGGAGCGTTTTCCTTCCCTCCATGGAGACTGCGTGGCCCTTCCCAATGGTGATGA TGGTGAATGTAGAGGAAATCTCTTCATGGATATTAATAACAAAATTGCCAACTTCTCACAGAGCTGTACC CTTTATTCAGGAGATGATTTGGTAGAAGCGCTTCCCAAGCCTTGCCCTGGCTGCCCCAGGGACATACCTG TAGACAGCCCAGAGCTGAAGGAGGTGCTTGGTCATTCCATTGCACAGCTAAATGCAGAGAATGACCATCC TTTCTATTACAAGATTGACACCGTGAAAAAAGCAACATCACAGGTGGTAGCAGGAACTAAATATGTTATT GAGTTCATAGCCAGAGAAACCAAATGCTCCAAGGAAAGTAACACAGAGCTGGCAGAAGATTGTGAGATCA AGCACCTTGGACAAAGTCTCGACTGCAATGCTAACGTGTACATGAGACCTTGGGAGAACAAAGTCGTCCC GACTGTGAAATGCCAAGCATTAGATATGACTGAAATGGCAAGAAGGCCTCCAGGTTTTTCTCCTTTCCGG AGTGTCACAGTACAAGAAACAAAAGAAGGAAGAACTAGGCTCCTACGCGCGTGCGAGTACAAGGGCAGAC TCTCAAAGGCAGGGGCAGAGCCAGCGCCTGAGCGTCAGGCAGAATCTTCACAAGTGAAGCAGTAGTCCCA GCAATGACCCAGAGGGAAGGACCAGAAGAATCCTGGGATGTGTGGAGCGCGGGACCATCGTCTTCATCAC CCTGATCCTAGTGGAAATAAAATTCAGACTTGATGAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_023125
Insert Size 1299 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC018158, AAH18158
RefSeq Size 1520 bp
RefSeq ORF 1299 bp
Locus ID 16644
UniProt ID O08677
Gene Summary (1) Kininogens are inhibitors of thiol proteases; (2) HMW-kininogen plays an important role in blood coagulation by helping to position optimally prekallikrein and factor XI next to factor XII; (3) HMW-kininogen inhibits the thrombin- and plasmin-induced aggregation of thrombocytes; (4) the active peptide bradykinin that is released from HMW-kininogen shows a variety of physiological effects: (4A) influence in smooth muscle contraction, (4B) induction of hypotension, (4C) natriuresis and diuresis, (4D) decrease in blood glucose level, (4E) it is a mediator of inflammation and causes (4E1) increase in vascular permeability, (4E2) stimulation of nociceptors (4E3) release of other mediators of inflammation (e.g. prostaglandins), (4F) it has a cardioprotective effect (directly via bradykinin action, indirectly via endothelium-derived relaxing factor action); (5) LMW-kininogen inhibits the aggregation of thrombocytes; (6) LMW-kininogen is in contrast to HMW-kininogen not involved in blood clotting (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) uses an alternate splice pattern in the 3' coding region, compared to variant 1. The resulting isoform (2), also known as LMW kininogen-I, has a shorter and distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The extent of this transcript is supported by transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...