Rangrf (NM_021329) Mouse Untagged Clone
CAT＃: MC203272
Rangrf (untagged) - Mouse RAN guanine nucleotide release factor (Rangrf), (10ug)
CNY 2400.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 2400006H24Rik; Mog1; Rangnrf |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC038470
CCACGCGTCCGGGGAGGAGGTAGTGGGTGCTCCGGGAACACCAGGGGAAATGATGTCTCAAAGGCTCATG TAGGTTTCTTTAAAACCTCGCTAATGTCCAGACTCAAGTACTAGATCTATGGAGCCCAACAGAAACTGTC CACTGTTCGGAGGCGCCTTCTCCGCCATCCTCCCTACAGGGGCCATTGATGTGAGTGACCTCCGACCGGT GCCAGACAACCAAGAAGTTTTCTGCCATCCTGTGACCGACCAGAGTCTGATCATAGAACTTCTGGAGCTG CAGGCCCACGTGCAGGGCGAAGCGGCTGCGCGGTACCATTTTGAGGACGTTGGCCGGGTGCAGGGGGCTA GGGCTGTGCACGTGCTATCTGTGCAGCCTCTCTGTTTGGAGAACTTATCCCTGAGAGGCTGCTGTCAGGA TGCCTGGTCCCTTTCTGGCAAGCAGCAGGTAGCTAAAGAAAACCAGCAGGTAGCAAAGGATGTCACACTG CATCAGGCCTTGCTGCGGCTGCCCCAGTATCAGACTGATCTTTTGCTCACCTTCAATCAGCCCCCGTGTC ACAGCAGGTCTCTTGGCCCTGAAAATCTGTCATGTCCACCTTGGAGCCTGAGTAACTTTGAACAGCTGGT AACTAGTTTGACTCTTCATGATCCCAACCTCTTTGGTCCCCAGTAAAGATCGTTGAGACACAACGTGCTA CTGAGGACTCGGGGACCCAGTTCTGAGAGGGGGAGTTTCTTTCTGCTTCTTCCCTGGATGTAAACATAAG ACACTTCCTCTGCAGAAATAAACTTGCTTTATGAAGAACATAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | RsrII-NotI |
| ACCN | NM_021329 |
| Insert Size | 558 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC038470, AAH38470 |
| RefSeq Size | 839 bp |
| RefSeq ORF | 558 bp |
| Locus ID | 57785 |
| UniProt ID | Q9JIB0 |
| Gene Summary | May regulate the intracellular trafficking of RAN (PubMed:10811801, PubMed:11733047). Promotes guanine nucleotide release from RAN and inhibits binding of new GTP by preventing the binding of the RAN guanine nucleotide exchange factor RCC1 (PubMed:10811801, PubMed:11733047). Regulates the levels of GTP-bound RAN in the nucleus, and thereby plays a role in the regulation of RAN-dependent mitotic spindle dynamics (By similarity). Enhances the expression of SCN5A at the cell membrane in cardiomyocytes (PubMed:18184654, PubMed:23420830).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (2) has a shorter and distinct N-terminus compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG201721 | Rangrf (tGFP-tagged) - Mouse RIKEN cDNA 2400006H24 gene (2400006H24Rik) |
CNY 2850.00 |
|
| MR201721 | Rangrf (Myc-DDK-tagged) - Mouse RAN guanine nucleotide release factor (Rangrf) |
CNY 2400.00 |
|
| MR201721L3 | Lenti ORF clone of Rangrf (Myc-DDK-tagged) - Mouse RAN guanine nucleotide release factor (Rangrf) |
CNY 4750.00 |
|
| MR201721L4 | Lenti ORF clone of Rangrf (mGFP-tagged) - Mouse RAN guanine nucleotide release factor (Rangrf) |
CNY 4750.00 |
