Psmb7 (NM_011187) Mouse Untagged Clone
CAT#: MC203582
Psmb7 (untagged) - Mouse proteasome (prosome, macropain) subunit, beta type 7 (Psmb7), (10ug)
CNY 2400.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | AU020723; MC14 |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC057662
GCAAGATGGCGGCTGTGTCGGTGTTTCAGCCACCGGTCGGAGGCTTTTCTTTTGATAATTGTCGCAGGAA TGCTGTCTTGGAAGCGGATTTCGCAAAAAAGGGGTTCAAGCTCCCGAAAGCTCGGAAAACTGGCACTACC ATCGCGGGGGTGGTGTATAAGGATGGCATAGTTCTTGGAGCAGACACGAGAGCAACTGAAGGGATGGTTG TTGCTGACAAAAACTGTTCAAAAATTCACTTCATATCTCCTAATATTTATTGCTGTGGTGCTGGGACAGC TGCAGACACAGACATGACAACCCAGCTTATTTCTTCCAACTTGGAGCTCCACTCTCTGACCACTGGCCGC CTCCCGAGAGTTGTTACAGCTAATCGGATGCTGAAGCAGATGCTCTTCAGGTATCAAGGTTACATTGGTG CAGCCCTAGTTTTGGGGGGAGTAGATGTTACTGGACCTCATCTCTACAGCATCTATCCTCATGGATCAAC TGATAAATTGCCTTATGTCACCATGGGTTCTGGCTCCTTGGCAGCAATGGCTGTGTTTGAAGATAAGTTT AGGCCAGATATGGAGGAGGAAGAAGCCAAGAAGCTAGTGAGTGAGGCTATTGCAGCTGGCATCTTTAATG ACTTGGGGTCTGGAAGCAACATTGATCTGTGTGTTATCAGCAAGAGCAAGCTGGACTTTCTTCGTCCATT CTCAGTGCCCAACAAGAAAGGGACCAGGCTTGGCCGGTACAGATGTGAGAAAGGCACTACCGCTGTCCTC ACCGAGAAAGTTACCCCTCTGGAGATTGAGGTGCTAGAAGAGACTGTTCAGACAATGGATACTTCGTGAA TGGTGCTGTGGGTGGTTGGATAACTCTAGATGACTCGGGGTGCATACCACCCCTACCCCAACCCCATTCT ACCCCAACCAGAAAACATGCCTTTGGCAATTGCTCAATTAAAATAAATAAATAAAAAGACAAAAAACTTA AAAAAAAAAAAAAAA |
| Restriction Sites | RsrII-NotI |
| ACCN | NM_011187 |
| Insert Size | 834 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC057662, AAH57662 |
| RefSeq Size | 995 bp |
| RefSeq ORF | 834 bp |
| Locus ID | 19177 |
| UniProt ID | P70195 |
| Gene Summary | Component of the 20S core proteasome complex involved in the proteolytic degradation of most intracellular proteins. This complex plays numerous essential roles within the cell by associating with different regulatory particles. Associated with two 19S regulatory particles, forms the 26S proteasome and thus participates in the ATP-dependent degradation of ubiquitinated proteins. The 26S proteasome plays a key role in the maintenance of protein homeostasis by removing misfolded or damaged proteins that could impair cellular functions, and by removing proteins whose functions are no longer required. Associated with the PA200 or PA28, the 20S proteasome mediates ubiquitin-independent protein degradation. This type of proteolysis is required in several pathways including spermatogenesis (20S-PA200 complex) or generation of a subset of MHC class I-presented antigenic peptides (20S-PA28 complex). Within the 20S core complex, PSMB7 displays a trypsin-like activity.[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG203729 | Psmb7 (tGFP-tagged) - Mouse proteasome (prosome, macropain) subunit, beta type 7 (Psmb7) |
CNY 2850.00 |
|
| MR203729 | Psmb7 (Myc-DDK-tagged) - Mouse proteasome (prosome, macropain) subunit, beta type 7 (Psmb7) |
CNY 2400.00 |
|
| MR203729L3 | Lenti ORF clone of Psmb7 (Myc-DDK-tagged) - Mouse proteasome (prosome, macropain) subunit, beta type 7 (Psmb7) |
CNY 4750.00 |
|
| MR203729L4 | Lenti ORF clone of Psmb7 (mGFP-tagged) - Mouse proteasome (prosome, macropain) subunit, beta type 7 (Psmb7) |
CNY 4750.00 |
