Tmem216 (NM_026798) Mouse Untagged Clone
CAT#: MC203636
Tmem216 (untagged) - Mouse transmembrane protein 216 (Tmem216), (10ug)
CNY 1200.00
CNY 2000.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 1110017C22Rik; 2810441K11Rik; 4921533J23Rik; A930021F15Rik; AI482550 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC052053
CATGGCGCCGCGAGGTGAGACTCTGGAGATAAAAGATTGTCCTCAACCCCCCTGGAAGTCCTGTTCTTTC TGAATGGGTGGTACTATGCTACCTATTTCCTGCTGGAGCTCCTTATTTTCCTGTACAAAGGGCTCCTGTT GCCGTACCCAACAGCCAACTTAGTCCTGGATGTGGTGATGCTGCTGCTCTATCTTGGCATTGAAGTCATA CGATTGTTTTTCGGTACAAAGGGAAACCTCTGCCAGCGAAAGATGCCCCTTGGCATTAGTGTGGCCTTGA CCTTCCCATCCGCTATGATGGCTTCCTATTACCTGCTGCTGCAGACCTACGTGCTCCGCCTAGAAGCTAT CATGAACAGTATCTTGCTCTTCTTTTGTGGCTCAGAGCTGCTGCTTGAGATGCTCACGCTGGCCACCTTC TCCAGCATGGACAGGATCTGAAGTACAAGAATTCCAGCTGGTGACAACACATATCCATCTGGTACTTCAG CCACACTGGTGAAAAGTGGTAGGTCGAGCTAACCTGGGAAAGGTTTGTGTGGTTTTTCCTCAGTGCGGAC ATTTGGGCGCTGAGCACCTACCTGAGGCCAGTGGCACCATCTTTAAAGCGGGATCATCAGCAGGAGACTC TTTCCTTTTGTTGTAGGGAGGGGCAAGGCTGTCCCCATCTTGGTGTTTCTAACAGCTTCCTAATGATCTC AAGTTCTCTTCTGTGGTCATCATGGCCAGAGCACCTTGTGTGGACCTTCTAGTTTTGTTTGGCTTCCAGC AGAACCTGAGCCACAGCACTCTGTGCACGTACATCTGTCCTACATGACCATGGAGAGCCTCATAATGGTG GGCTCTTGGGCTGATTCCAATGTGTGTTCTCCACGCTGCTCCACCTGCCCCCATCCTGCTCAAAGAGATG GTGATCTAGAACCCATTTAGTAGTTTATAGTAGTATTTTTCTATTCTGATCATGAAGCAAACACAAAATT TTTAATAAAAGTATTTTCTGATAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAA |
Restriction Sites | AscI-NotI |
ACCN | NM_026798 |
Insert Size | 264 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC052053, AAH52053 |
RefSeq Size | 1053 bp |
RefSeq ORF | 264 bp |
Locus ID | 68642 |
UniProt ID | Q9CQC4 |
Gene Summary | This gene encodes a transmembrane protein which is involved in regulation of signaling and trafficking of associated proteins. In humans, mutations in this gene are associated with ciliopathies including Joubert, Meckel and related syndromes. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2013] Transcript Variant: This variant (2) contains an alternate 5' terminal exon, differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream start codon, compared to variant 1. Variants 2 and 3 encode the same isoform (2), which has a shorter N-terminus compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG200195 | Tmem216 (tGFP-tagged) - Mouse RIKEN cDNA 2810441K11 gene (2810441K11Rik) |
CNY 2850.00 |
|
MR200195 | Tmem216 (Myc-DDK-tagged) - Mouse transmembrane protein 216 (Tmem216) |
CNY 1200.00 |
|
MR200195L3 | Lenti ORF clone of Tmem216 (Myc-DDK-tagged) - Mouse transmembrane protein 216 (Tmem216) |
CNY 4750.00 |
|
MR200195L4 | Lenti ORF clone of Tmem216 (mGFP-tagged) - Mouse transmembrane protein 216 (Tmem216) |
CNY 4750.00 |
其它Tmem216产品