Sdhaf4 (NM_026503) Mouse Untagged Clone
CAT#: MC204138
1110058L19Rik (untagged) - Mouse RIKEN cDNA 1110058L19 gene (1110058L19Rik), (10ug)
CNY 1200.00
CNY 2000.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 1110058L19Rik; 1700001E18Rik; C6orf57 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC028981
GCGCAATGGTCTCCACGACCCTTTCCGTTTCACGGATGACTTTCGTCTGGAGAGCAGCAAGACCATCTCT TCTGAATCATTCTTTGAGGAAAATGAGTTATCAGGAAGGAAAGCCTGAGCCTGCGAAGCAAGCCCTTAAG AAGTCAAAGCTGCCACTCGGTCGTTTTGACTCACTGGAGGATTCACCCGAAGAGAGAGAGCCACTGCAGA AGTTTCCGGATGATGTAAATCCAGTTACCAAAGAAAAAGGTGGACCCAAGGGCCCGGAGCCTACACGATA TGGAGACTGGGAACGGAAGGGACGCTGCATTGACTTTTAAGTCACGCACTCTCACAACTGCAGAATCATT ACCTGAACTGTTTACTTCAAGTTGTTTTCTTTTTCTGTGTCCTTTAAGTGTGTAATTTCCATCGTATGTC CTAAAATGCATGTGACAGCTTTGAATAGCAAATGCTGCTATAGATGAGGAATGTGGAAACGCTTCCATTA GCATCTTAACCTCACCTTAAGTGTGTCAGGGCAGAGTCTGGGATGAGAGCATCAAGTCTTTGCCACGATC TTTTTGTCATTTATTTAATCAGTTGCTTATAAAATACATGTGTAAATAAAGACCTCTTGAAATTTTTAAA AAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_026503 |
Insert Size | 315 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC028981, AAH28981 |
RefSeq Size | 653 bp |
RefSeq ORF | 315 bp |
Locus ID | 68002 |
UniProt ID | Q8BTE0 |
Gene Summary | Plays an essential role in the assembly of succinate dehydrogenase (SDH), an enzyme complex (also referred to as respiratory complex II) that is a component of both the tricarboxylic acid (TCA) cycle and the mitochondrial electron transport chain, and which couples the oxidation of succinate to fumarate with the reduction of ubiquinone (coenzyme Q) to ubiquinol (PubMed:24954416). Binds to the flavoprotein subunit Sdha in its FAD-bound form, blocking the generation of excess reactive oxigen species (ROS) and facilitating its assembly with the iron-sulfur protein subunit Sdhb into the SDH catalytic dimer (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG200347 | 1110058L19Rik (tGFP-tagged) - Mouse RIKEN cDNA 1110058L19 gene (1110058L19Rik) |
CNY 2850.00 |
|
MR200347 | 1110058L19Rik (Myc-DDK-tagged) - Mouse RIKEN cDNA 1110058L19 gene (1110058L19Rik) |
CNY 1200.00 |
|
MR200347L3 | Lenti ORF clone of 1110058L19Rik (Myc-DDK-tagged) - Mouse RIKEN cDNA 1110058L19 gene (1110058L19Rik) |
CNY 4750.00 |
|
MR200347L4 | Lenti ORF clone of 1110058L19Rik (mGFP-tagged) - Mouse RIKEN cDNA 1110058L19 gene (1110058L19Rik) |
CNY 4750.00 |