Sdhaf4 (NM_026503) Mouse Untagged Clone

CAT#: MC204138

1110058L19Rik (untagged) - Mouse RIKEN cDNA 1110058L19 gene (1110058L19Rik), (10ug)



  "NM_026503" in other vectors (4)

CNY 1200.00

CNY 2000.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 1110058L19Rik; 1700001E18Rik; C6orf57
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC028981
GCGCAATGGTCTCCACGACCCTTTCCGTTTCACGGATGACTTTCGTCTGGAGAGCAGCAAGACCATCTCT TCTGAATCATTCTTTGAGGAAAATGAGTTATCAGGAAGGAAAGCCTGAGCCTGCGAAGCAAGCCCTTAAG AAGTCAAAGCTGCCACTCGGTCGTTTTGACTCACTGGAGGATTCACCCGAAGAGAGAGAGCCACTGCAGA AGTTTCCGGATGATGTAAATCCAGTTACCAAAGAAAAAGGTGGACCCAAGGGCCCGGAGCCTACACGATA TGGAGACTGGGAACGGAAGGGACGCTGCATTGACTTTTAAGTCACGCACTCTCACAACTGCAGAATCATT ACCTGAACTGTTTACTTCAAGTTGTTTTCTTTTTCTGTGTCCTTTAAGTGTGTAATTTCCATCGTATGTC CTAAAATGCATGTGACAGCTTTGAATAGCAAATGCTGCTATAGATGAGGAATGTGGAAACGCTTCCATTA GCATCTTAACCTCACCTTAAGTGTGTCAGGGCAGAGTCTGGGATGAGAGCATCAAGTCTTTGCCACGATC TTTTTGTCATTTATTTAATCAGTTGCTTATAAAATACATGTGTAAATAAAGACCTCTTGAAATTTTTAAA AAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_026503
Insert Size 315 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC028981, AAH28981
RefSeq Size 653 bp
RefSeq ORF 315 bp
Locus ID 68002
UniProt ID Q8BTE0
Gene Summary Plays an essential role in the assembly of succinate dehydrogenase (SDH), an enzyme complex (also referred to as respiratory complex II) that is a component of both the tricarboxylic acid (TCA) cycle and the mitochondrial electron transport chain, and which couples the oxidation of succinate to fumarate with the reduction of ubiquinone (coenzyme Q) to ubiquinol (PubMed:24954416). Binds to the flavoprotein subunit Sdha in its FAD-bound form, blocking the generation of excess reactive oxigen species (ROS) and facilitating its assembly with the iron-sulfur protein subunit Sdhb into the SDH catalytic dimer (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...