Cxcl17 (NM_153576) Mouse Untagged Clone
CAT#: MC204228
Cxcl17 (untagged) - Mouse chemokine (C-X-C motif) ligand 17 (Cxcl17), (10ug)
CNY 1800.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | VCC-1; Vcc1 |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC024561
GTAGGATTAAATTGTAGACACTACTCCACCTGAGCAGTTACAAGAAATCAGAAGCCTCTAACTGGTGACA ATCCACACAGCCTTTAAGAACCAACAGACAGCCACAATGAAGCTTCTAGCCTCTCCCTTCCTTCTGTTGC TTCCAGTGATGCTCATGTCCATGGTCTTCAGCAGCCCGAACCCAGGGGTCGCCAGAAGCCACGGGGACCA ACACCTGGCTCCTAGGAGGTGGCTCTTGGAAGGTGGCCAAGAATGTGAATGCAAAGATTGGTTCCTGCAA GCCCCAAAGAGAAAAGCCACAGCAGTGCTGGGGCCACCAAGGAAGCAGTGTCCCTGTGATCACGTCAAGG GCAGGGAGAAAAAAAAACAGACACCAAAAGCACCACAGGAAGTCGCAAAGACCCTCCAGAGCCTGCCAGC AATTTCTCAAACGATGTCACCTGGCAAGCTTTGCGCTGCCCTTATAGTACTGAGACTCTGCTCCTCTAGT TAGACTCTCTCAGTGGAAAGGAGGTGACCAGCCCTAGCACGGTTCTTATTCTCCCCACCCCCATCCTCAC CAAGAGCACCCCAGTGCTCTCTGAAGGCACTGCCTCACAGTGTATCTATGACTGTGCCCCTAGTGCCGGC TGCACTTGCCACTCTTGTCTTATGCCTTCTGTTTACCCTACAAGAATGCAGGACACCTCGGCCTCCTGTT GGCCTCACATTGCAATCAGAAAACTTGCAATGAAAATAATTAAATACATAGTGCATACGTGAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | RsrII-NotI |
| ACCN | NM_153576 |
| Insert Size | 387 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC024561, AAH24561 |
| RefSeq Size | 808 bp |
| RefSeq ORF | 387 bp |
| Locus ID | 232983 |
| UniProt ID | Q5UW37 |
| Gene Summary | Chemokine that acts as chemoattractant for monocytes, macrophages and dendritic cells (PubMed:24973458). Plays a role in angiogenesis and possibly in the development of tumors (PubMed:16989774). Acts as an anti-inflammatory in the stomach. May play a role in the innate defense against infections. Activates the C-X-C chemokine receptor GPR35 to induce a rapid and transient rise in the level of intracellular calcium ions.[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG200701 | Cxcl17 (tGFP-tagged) - Mouse cDNA sequence BC024561 (BC024561) |
CNY 4370.00 |
|
| MR200701 | Cxcl17 (Myc-DDK-tagged) - Mouse chemokine (C-X-C motif) ligand 17 (Cxcl17) |
CNY 1800.00 |
|
| MR200701L3 | Lenti ORF clone of Cxcl17 (Myc-DDK-tagged) - Mouse chemokine (C-X-C motif) ligand 17 (Cxcl17) |
CNY 5890.00 |
|
| MR200701L4 | Lenti ORF clone of Cxcl17 (mGFP-tagged) - Mouse chemokine (C-X-C motif) ligand 17 (Cxcl17) |
CNY 5890.00 |
