Gpr183 (NM_183031) Mouse Untagged Clone

CAT#: MC204734

Gpr183 (untagged) - Mouse G protein-coupled receptor 183 (Gpr183), (10ug)



  "NM_183031" in other vectors (4)

CNY 3656.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms Ebi2
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC052868
AAGAGGTAATCCACTGCCACAACGGAGGTCCTAGCCACCTTCTGATATTGACTGTGACCACTGGATACAG AAATGGCTAACAATTTCACTACCCCACTGGCAACGTCTCATGGCAATAACTGTGATCTCTATGCCCACCA CAGCACAGCCAGGGTATTAATGCCTCTGCATTACAGCCTGGTCTTCATCATTGGGCTGGTGGGAAACCTG CTGGCCTTGGTTGTCATTGTTCAAAACAGAAAAAAAATCAACTCAACCACTCTCTATTCAATGAACTTGG TCATTTCTGACATCCTGTTTACCACAGCTTTACCCACTCGGATAGCCTACTATGCGCTGGGCTTTGATTG GAGGATAGGTGATGCCCTGTGCCGGGTAACTGCTCTGGTGTTCTACATCAACACGTACGCAGGTGTGAAC TTCATGACTTGCTTGAGCATAGACCGCTTCTTCGCTGTGGTGCACCCTCTGCGCTACAACAAGATTAAAA GAATCGAATACGCAAAGGGTGTCTGCCTGTCCGTCTGGATTCTGGTCTTTGCTCAAACACTGCCGCTGTT CCTCACCCCTATGTCTAAGGAGGAGGGAGACAAGACCACTTGCATGGAGTATCCAAACTTTGAAGGGACA GCGTCCCTGCCGTGGATTCTGCTCGGAGCCTGTCTGCTGGGCTACGTGCTGCCTATCACAGTCATTCTCC TGTGTTACTCTCAGATCTGCTGCAAACTCTTCAGGACTGCCAAGCAGAACCCACTCACCGAGAAATCTGG TGTGAACAAAAAGGCTCTCAACACAATTATCCTCATCATTGTCGTGTTCATCCTGTGCTTCACGCCCTAC CACGTGGCCATCATTCAGCACATGATAAAGATGCTCTGCTCCCCTGGAGCCCTGGAGTGTGGGGCGAGAC ATTCCTTCCAGATCTCTCTGCACTTCACGGTGTGCCTGATGAACTTCAACTGCTGCATGGACCCGTTCAT ATACTTCTTTGCATGCAAAGGGTATAAGAGAAAGGTCATGAAGATGCTCAAACGTCAAGTGAGTGTGTCG ATCTCCAGCGCAGTGAGGTCAGCCCCTGAAGAGAGTTCGCGGGAAATGACAGAGTCTCAGATGATGATCC ACTCCAAGGCCTCCAATGGAAGGTAAAGGCACTTGGGACTTCACAGCACAGCAAGCTGCGGGATGGGCCC CGCCCACCGACTGGTCGGCTCCCAACCAGGATGCCTTCCACTGCCGCCCCACCGGCCAATGCACTGAGAT CCAGACCAGATCGAGGAGACAAAAAAGCAAGTTCAACTTCATAAATGAAATATAATGTATATAAAGGAAG GCCCTCATAAGTCTCAATGTAAAAAGAAATTCTTTGTGAAATTACTATTTCTTGTCAATAGTTTGGCAAA AGACGACTAATTGCACTGTATATTGCCAGTGTAAAAATGTTAATACTGTAATATATGAATATATTTCTTA ATTTAAAAAAAAAAAAAAAAAAG
Restriction Sites RsrII-NotI     
ACCN NM_183031
Insert Size 1074 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC052868, AAH52868
RefSeq Size 1493 bp
RefSeq ORF 1074 bp
Locus ID 321019
UniProt ID Q3U6B2
Gene Summary G-protein coupled receptor expressed in lymphocytes that acts as a chemotactic receptor for B-cells, T-cells, splenic dendritic cells, monocytes/macrophages and astrocytes (PubMed:19597478, PubMed:19615922, PubMed:21844396, PubMed:21796211, PubMed:21796212, PubMed:27147029). Receptor for oxysterol 7-alpha,25-dihydroxycholesterol (7-alpha,25-OHC) and other related oxysterols (PubMed:21796211, PubMed:21796212). Mediates cell positioning and movement of a number of cells by binding the 7-alpha,25-OHC ligand that forms a chemotactic gradient (PubMed:21796211, PubMed:21796212, PubMed:27147029). Binding of 7-alpha,25-OHC mediates the correct localization of B-cells during humoral immune responses (PubMed:21796211, PubMed:21796212). Collaborates with CXCR5 to mediate B-cell migration; probably by forming a heterodimer with CXCR5 that affects the interaction between of CXCL13 and CXCR5 (PubMed:21948984, PubMed:22913878). Guides B-cell movement along the B-cell zone-T-cell zone boundary and later to interfollicular and outer follicular regions (PubMed:19615922, PubMed:19597478, PubMed:21844396). Its specific expression during B-cell maturation helps position B-cells appropriately for mounting T-dependent antibody responses (PubMed:19615922). Also acts as a chemotactic receptor for some T-cells upon binding to 7-alpha,25-OHC ligand (PubMed:27147029). Promotes follicular helper T (Tfh) cells differentiation by positioning activated T-cells at the follicle-T-zone interface, promoting contact of newly activated CD4 T-cells with activated dendritic cells and exposing them to Tfh-cell-promoting inducible costimulator (ICOS) ligand (PubMed:27147029). Expression in splenic dendritic cells is required for their homeostasis, localization and ability to induce B- and T-cell responses: GPR183 acts as a chemotactic receptor in dendritic cells that mediates the accumulation of CD4(+) dendritic cells in bridging channels (PubMed:23682316, PubMed:23502855). Regulates migration of astrocytes and is involved in communication between astrocytes and macrophages (PubMed:25297897, PubMed:27166278). Promotes osteoclast precursor migration to bone surfaces (PubMed:26438360). Signals constitutively through G(i)-alpha, but not G(s)-alpha or G(q)-alpha (By similarity). Signals constitutively also via MAPK1/3 (ERK1/2) (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...