Ethe1 (NM_023154) Mouse Untagged Clone
CAT#: MC204811
Ethe1 (untagged) - Mouse ethylmalonic encephalopathy 1 (Ethe1), nuclear gene encoding mitochondrial protein, (10ug)
CNY 2400.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 0610025L15Rik; Hsco |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC083162
GCGATGGCGAGCGCGGTCGTCAGGGTCGCCGGGCGGCGGCTGAGCCAGCAAAGCGCATCCGGAGCCCCGG TCCTCCTGCGGCAGATGTTTGAACCCAAGAGCTGCACCTATACCTACCTTCTGGGTGACCGGGAGTCAAG AGAGGCAGTTCTGATCGACCCCGTTCTGGAGACAGCGCATCGGGATGCTCAGTTGATTAAGGAGCTGGGG CTCAAGCTGTTGTACGCTGTGAACACTCACTGCCATGCTGACCACATCACCGGCACGGGGGTTCTCCGGT CCCTGCTCCCGGGCTGCCAGTCTGTCATCTCCCGCCTCAGCGGAGCCCAGGCTGATTTGCATATCGGGGA AGGTGATTCCATCCGCTTTGGACGCTTTGCTTTGGAGACTCGAGCCAGCCCTGGCCACACTCCAGGCTGT GTCACCTTTGTCCTGAACGACCAGAGCATGGCCTTCACTGGAGATGCCCTGCTGATCCGAGGGTGTGGAC GGACAGACTTCCAACAAGGCTGTGCTAAGACTTTGTACCACTCTGTGCACGAGAAGATCTTCACACTTCC AGGCAACTGTCTAATCTACCCGGCTCACGATTACCACGGGCTCACAGTTTCTACTGTGGAGGAGGAACGG ACTCTGAACCCACGGCTTACCCTCAGCTGTGAGGAATTTATCAAGGTCATGGACAACCTGAACTTGCCCA AGCCACAGCAGATAGACATTGCTGTTCCTGCAAATATGCGCTGTGGGGTCCAGACTCCACCCTCCTGATT CGTCCCAGCCAGCTGCTCACATCCGTTATGAATGCACTAGGAGGGGTGAGGGGAGGGGTGTCACCCCAGG GCCTCTCTCTTCTCCTACCTCTACTCTCACCAGCTACTTGAGCTTCTTAAATAAAGTTTACTTCGTTTTT GCCACGAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_023154 |
Insert Size | 765 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC083162, AAH83162 |
RefSeq Size | 936 bp |
RefSeq ORF | 765 bp |
Locus ID | 66071 |
UniProt ID | Q9DCM0 |
Gene Summary | First described as a protein that can shuttle between the nucleus and the cytoplasm and suppress p53-induced apoptosis by sequestering the transcription factor RELA/NFKB3 in the cytoplasm and preventing its accumulation in the nucleus (By similarity). Sulfur dioxygenase that plays an essential role in hydrogen sulfide catabolism in the mitochondrial matrix. Hydrogen sulfide (H(2)S) is first oxidized by SQRDL, giving rise to cysteine persulfide residues. ETHE1 consumes molecular oxygen to catalyze the oxidation of the persulfide, once it has been transferred to a thiophilic acceptor, such as glutathione (R-SSH). Plays an important role in metabolic homeostasis in mitochondria by metabolizing hydrogen sulfide and preventing the accumulation of supraphysiological H(2)S levels that have toxic effects, due to the inhibition of cytochrome c oxidase.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG203256 | Ethe1 (tGFP-tagged) - Mouse ethylmalonic encephalopathy 1 (Ethe1) |
CNY 2850.00 |
|
MR203256 | Ethe1 (Myc-DDK-tagged) - Mouse ethylmalonic encephalopathy 1 (Ethe1), nuclear gene encoding mitochondrial protein |
CNY 2400.00 |
|
MR203256L3 | Lenti ORF clone of Ethe1 (Myc-DDK-tagged) - Mouse ethylmalonic encephalopathy 1 (Ethe1), nuclear gene encoding mitochondrial protein |
CNY 4750.00 |
|
MR203256L4 | Lenti ORF clone of Ethe1 (mGFP-tagged) - Mouse ethylmalonic encephalopathy 1 (Ethe1), nuclear gene encoding mitochondrial protein |
CNY 4750.00 |