Pin1 (NM_023371) Mouse Untagged Clone

CAT#: MC204855

Pin1 (untagged) - Mouse protein (peptidyl-prolyl cis/trans isomerase) NIMA-interacting 1 (Pin1), (10ug)



  "NM_023371" in other vectors (4)

CNY 1200.00

CNY 2000.00


货期*
现货

规格
    • 10 ug

Cited in 1 publication.

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 0610025L01Rik; D9Bwg1161e
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC038254
CCACGCGTCCGGGGAAGATGGCGGACGAGGAGAAGCTGCCACCAGGCTGGGAGAAGCGTATGAGTCGCAG CTCAGGCCGGGTGTACTACTTCAATCACATCACCAACGCCAGCCAGTGGGAGCGGCCCAGCGGCGGCAGC ACTGTTGGAGGCAGCAGCAAGAATGGCCAGGGTGAGCCTGCCAAGGTGCGCTGCTCACATCTGCTGGTGA AGCACAGCCAGTCTCGGAGGCCCTCATCCTGGCGGCAGGAAAAGATCACCAGGAGCAAGGAGGAGGCCCT GGAGCTCATCAATGGCTATATCCAGAAGATTAAGTCAGGAGAGGAAGACTTTGAATCTCTGGCCTCACAG TTCAGTGATTGCAGCTCTGCCAAAGCCAGGGGAGACCTGGGTCCCTTCAGCAGAGGTCAGATGCAGAAAC CATTTGAGGATGCGTCGTTTGCTCTACGGACAGGGGAGATGAGTGGGCCCGTGTTCACGGACTCGGGCAT CCATATCATCCTGCGCACAGAATGAGGGCAGGCACCTGGCCAGCCTGCTCTGGCTGCCACACAGCCCACG GATGCCCTTCCTGCTACTGTCACACAGTATTTATTGTTCCTAAAATGACTGGGAGGGGCTCTGAGCATCC CGCTCCCTGTTTGCCCCTATTCGGGGCTGTCCTAGCCAGGCTCCTTCTGGAGGAATTGACTTCAGAAGGG CAGTGGGGATGGGGAGGCCCCCAGGCTCAGGGGGTCAGAGGTGACCTGATCCCCCAGGTCTCAGAGGCAG GCAGGAGGGCCTTCTTTCTTGTTAGTTATATGCTCCATTCGTTCCTCTGTTCAGTTGCAAAAAGCAGACG CTCCATACCTGGCGGTGCAGCAACTCAGCCTCAGGGTGCAGTGCAGCACCCTACGCACCTTCCATTAAAT CTGGAACCACTAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_023371
Insert Size 498 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC038254, AAH38254
RefSeq Size 936 bp
RefSeq ORF 498 bp
Locus ID 23988
UniProt ID Q9QUR7
Gene Summary Peptidyl-prolyl cis/trans isomerase (PPIase) that binds to and isomerizes specific phosphorylated Ser/Thr-Pro (pSer/Thr-Pro) motifs. By inducing conformational changes in a subset of phosphorylated proteins, acts as a molecular switch in multiple cellular processes. Displays a preference for an acidic residue N-terminal to the isomerized proline bond. Regulates mitosis presumably by interacting with NIMA and attenuating its mitosis-promoting activity. Down-regulates kinase activity of BTK. Can transactivate multiple oncogenes and induce centrosome amplification, chromosome instability and cell transformation. Required for the efficient dephosphorylation and recycling of RAF1 after mitogen activation (By similarity). Binds and targets PML and BCL6 for degradation in a phosphorylation-dependent manner (PubMed:17828269). Acts as a regulator of JNK cascade by binding to phosphorylated FBXW7, disrupting FBXW7 dimerization and promoting FBXW7 autoubiquitination and degradation: degradation of FBXW7 leads to subsequent stabilization of JUN (By similarity). May facilitate the ubiquitination and proteasomal degradation of RBBP8/CtIP through CUL3/KLHL15 E3 ubiquitin-protein ligase complex, hence favors DNA double-strand repair through error-prone non-homologous end joining (NHEJ) over error-free, RBBP8-mediated homologous recombination (HR) (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Other Versions

Customer Reviews 
Loading...