U2af1l4 (NM_170760) Mouse Untagged Clone
CAT#: MC204955
U2af1l4 (untagged) - Mouse U2 small nuclear RNA auxiliary factor 1-like 4 (U2af1l4), (10ug)
CNY 2400.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | AA407033; AF419339; AI451269; AW553050; U2af26 |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC060972
GAGTGTTCGGGTAAAAATGGCTGAATATTTAGCTTCGATATTCGGGACTGAGAAGGACAAGGTTAACTGC TCTTTTTACTTTAAGATTGGAGCCTGCCGGCACGGGGACCGGTGCTCCCGACTTCACAACAAACCGACTT TCAGCCAGACCATAGTCCTGCTCAACTTGTACCGGAATCCACAGAACACAGCCCAAACTGCAGATGGATC ACACTGTCACGTGAGCGACGTGGAGGTGCAAGAACACTATGATAACTTCTTTGAGGAGGTATTCACAGAA CTGCAGGAGAAGTATGGAGAGATTGAAGAGATGAATGTGTGTGACAACCTCGGGGACCACCTCGTGGGCA ATGTCTACGTTAAGTTCCGGCGGGAGGAGGATGCAGAGCGGGCTGTAGCGGAACTCAATAACCGCTGGTT CAACGGGCAGGCTGTGCATGCCGAGCTGTCTCCTGTCACTGACTTCCGAGAGTCCTGCTGCCGGCAGTAT GAGATGGGGGAATGCACCCGAGGTGGCTTCTGCAACTTTATGCACCTACGGCCCATATCTCGGAACTTGC GCCGGCAGCTCTATGGGCGAGGACCCAGGCATAGGTCACCTCCAAGGTCCCACACAGGTCACCGTCCCCG AGAAAGGAACCGACGTCGTTCCCCAGACCACCGGCATGGTCGCTTCTGAGACGGGTCCCCTTGCTCTCCA CCCAAGGGCATAGATGTTCCTGTCCAGCGTCCCTTTTCAAAGTGCCCTTCACTCTCCAGTCCCAGCATCC CCAGGCTTCGGAGCTTCATAATATAATCTGTTCGACACAGGAACCTCCTCCTCCTGTCCCTCCTCCAATA AAGGTTAAGAAGTTTGTCAATCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | SfiI-SfiI |
| ACCN | NM_170760 |
| Insert Size | 663 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC060972, AAH60972 |
| RefSeq Size | 892 bp |
| RefSeq ORF | 663 bp |
| Locus ID | 233073 |
| UniProt ID | Q8BGJ9 |
| Gene Summary | RNA-binding protein that function as a pre-mRNA splicing factor. Plays a critical role in both constitutive and enhancer-dependent splicing by mediating protein-protein interactions and protein-RNA interactions required for accurate 3'-splice site selection. It can functionally substitute for U2AF1 in constitutive splicing and enhancer-dependent splicing. Acts by enhancing the binding of U2AF2 to weak pyrimidine tracts. Also participates in the regulation of alternative pre-mRNA splicing. Activates exon 5 skipping of PTPRC during T-cell activation; an event reversed by GFI1. Binds to RNA at the AG dinucleotide at the 3'-splice site. Shows a preference for AGC or AGA (PubMed:11739736, PubMed:16819553, PubMed:18460468). Alternative splicing of U2AF1L4 may play a role in connecting the circadian rhythm to changing external cues: may provide a circadian buffering system in central and periphery clocks that allows synchronized adaption to clock-resetting stimuli in order to prevent potentially pathogenic desynchronization (PubMed:24837677).[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG202513 | U2af1l4 (tGFP-tagged) - Mouse U2 small nuclear RNA auxiliary factor 1-like 4 (U2af1l4) |
CNY 2850.00 |
|
| MR202513 | U2af1l4 (Myc-DDK-tagged) - Mouse U2 small nuclear RNA auxiliary factor 1-like 4 (U2af1l4) |
CNY 2400.00 |
|
| MR202513L3 | Lenti ORF clone of U2af1l4 (Myc-DDK-tagged) - Mouse U2 small nuclear RNA auxiliary factor 1-like 4 (U2af1l4) |
CNY 4750.00 |
|
| MR202513L4 | Lenti ORF clone of U2af1l4 (mGFP-tagged) - Mouse U2 small nuclear RNA auxiliary factor 1-like 4 (U2af1l4) |
CNY 4750.00 |
其它U2af1l4产品
