Pabpn1 (NM_019402) Mouse Untagged Clone
CAT＃: MC205561
Pabpn1 (untagged) - Mouse poly(A) binding protein, nuclear 1 (Pabpn1), (10ug)
CNY 2400.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | mPABII; PAB2; Pabp3 |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC055866
CGATGGCGGCGGCGGCGGCGGCGGCAGCAGCAGCGGGGGCTGCGGGCGGTCGGGGCTCCGGGCCGGGGCG GCGGCGCCATCTTGTGCCCGGGGCCGGTGGGGAGGCCGGGGAGGGGGACCCGGGGGGCGCAGGGGACTAC GGGAACGGCCTGGAGTCTGAGGAGCTGGAGCCTGGGGAGCTGCTGCCGGAGCCCGAGCCCGAAGAGGAGC CGCCCCGGCCCCGCGCCCCTCCGGGAGCTCCGGGTCCTGGGCCCGGCTCGGGAGCCCCCGGCAGTCAGGA GGAGGAGGAAGAGCCGGGACTGGTTGAGGCCGACCCCGGCGACGGCGCCATTGAGGACCCGGAGCTAGAA GCGATCAAAGCTCGAGTCAGGGAGATGGAGGAAGAGGCTGAGAAGCTAAAGGAGCTACAAAACGAGGTAG AGAAGCAGATGAATATGAGTCCACCCCCAGGCAATGCTGGCCCAGTGATCATGTCTCTTGAGGAGAAGAT GGAGGCTGATGCCCGCTCTATCTACGTTGGCAATGTGGACTATGGTGCAACAGCAGAAGAGCTGGAAGCC CATTTTCATGGCTGTGGTTCAGTCAACCGTGTTACTATACTCTGTGACAAATTTAGTGGCCATCCCAAAG GGTTTGCATATATAGAGTTCTCGGACAAAGAGTCAGTGAGGACGTCCCTGGCCTTAGATGAGTCCCTGTT CAGAGGAAGACAAATCAAGGTGATTCCCAAACGAACCAACAGACCAGGCATCAGCACAACAGACCGGGGT TTCCCGCGCTCCCGATACCGTGCCCGGACTACCAACTACAACAGCTCCCGATCTCGATTCTACAGTGGTT TTAACAGCAGGCCCCGGGGTCGAATCTACAGGGGCCGGGCTAGAGCGACATCATGGTATTCCCCTTACTA AAAAAAGTGTGTATTAGGAGGAGAGAGAGAAAAAAAAGAGGAAAGAAGGAAAAAAAAAAGAATTAAAAAA AAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | RsrII-NotI |
| ACCN | NM_019402 |
| Insert Size | 909 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC055866, AAH55866 |
| RefSeq Size | 1002 bp |
| RefSeq ORF | 909 bp |
| Locus ID | 54196 |
| UniProt ID | Q8CCS6 |
| Gene Summary | Involved in the 3'-end formation of mRNA precursors (pre-mRNA) by the addition of a poly(A) tail of 200-250 nt to the upstream cleavage product. Stimulates poly(A) polymerase (PAPOLA) conferring processivity on the poly(A) tail elongation reaction and controls also the poly(A) tail length. Increases the affinity of poly(A) polymerase for RNA. Is also present at various stages of mRNA metabolism including nucleocytoplasmic trafficking and nonsense-mediated decay (NMD) of mRNA. Cooperates with SKIP to synergistically activate E-box-mediated transcription through MYOD1 and may regulate the expression of muscle-specific genes. Binds to poly(A) and to poly(G) with high affinity. May protect the poly(A) tail from degradation. Subunit of the trimeric poly(A) tail exosome targeting (PAXT) complex, a complex that directs a subset of long and polyadenylated poly(A) RNAs for exosomal degradation. The RNA exosome is fundamental for the degradation of RNA in eukaryotic nuclei. Substrate targeting is facilitated by its cofactor MTREX, which links to RNA-binding protein adapters (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG204225 | Pabpn1 (tGFP-tagged) - Mouse poly(A) binding protein, nuclear 1 (Pabpn1) |
CNY 2850.00 |
|
| MR204225 | Pabpn1 (Myc-DDK-tagged) - Mouse poly(A) binding protein, nuclear 1 (Pabpn1) |
CNY 2400.00 |
|
| MR204225L3 | Lenti ORF clone of Pabpn1 (Myc-DDK-tagged) - Mouse poly(A) binding protein, nuclear 1 (Pabpn1) |
CNY 4750.00 |
|
| MR204225L4 | Lenti ORF clone of Pabpn1 (mGFP-tagged) - Mouse poly(A) binding protein, nuclear 1 (Pabpn1) |
CNY 4750.00 |
