Iscu (NM_025526) Mouse Untagged Clone
CAT＃: MC205875
Iscu (untagged) - Mouse IscU iron-sulfur cluster scaffold homolog (E. coli) (Iscu), nuclear gene encoding mitochondrial protein, (10ug)
CNY 2400.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 2310020H20Rik; AA407971; Nifu; Nifun |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC048409
TCAAGCCGGCAGGATGGCGGCGGCCACGGGAGCTGGCCGTCTGAGGCGGGCGGCGTCGGCGCTGCTGCTG CGGAGCCCGCGCCTGCCCGCCCGGGAGCTGTCGGCTCCGGCCAGGCTCTACCACAAGAAGGTTGTGGATC ATTATGAAAACCCTCGGAACGTGGGATCCCTTGACAAGACATCTAAAAATGTTGGAACCGGATTGGTGGG GGCTCCGGCATGTGGTGACGTCATGAAACTGCAGATCCAGGTGGATGAAAAGGGGAAGATTGTGGACGCC AGATTCAAAACATTTGGCTGCGGCTCCGCCATTGCCTCCAGCTCCTTAGCCACAGAGTGGGTAAAGGGGA AAACGGTGGAGGAAGCCCTGACCATCAAAAACACCGACATCGCCAAGGAGCTCTGCCTGCCGCCTGTGAA ACTGCACTGCTCCATGCTGGCAGAAGACGCCATCAAGGCCGCCCTGGCTGACTACAAACTGAAGCAAGAG TCCAAGAAGGAGGAGCCAGAGAAGCAGTGAGCCCTGGAGACACTCCAGCCAGTCACAGCAGCTGCTTCCT GCCACCCTGCACATCAAAGAAGCTACGCAAAACGCACACTATTCACCACTTGCACAAAATGTGCCGTTGA TTACACCTGATCCCGTGTTCCTTTCAGCTCACGTGTGTCCTTAGTGCAGTTAGTGTCTTGATTTAGTTTG TGGCCTGGGACTGAAATCAGCACCGAAGTCTTAAGCTCTGGAGAGTGACAAGGACTTGTACCTGACCTGA GGTAGATTGCCAGCAGAGCGCCTTATGCTGGCTATCTGATAGGATCTATTACTGAGTATTTAGCAGATCT GCATATATATATTATAATAAAAATGTGAGACAATGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | RsrII-NotI |
| ACCN | NM_025526 |
| Insert Size | 507 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC048409, AAH48409 |
| RefSeq Size | 935 bp |
| RefSeq ORF | 507 bp |
| Locus ID | 66383 |
| UniProt ID | Q9D7P6 |
| Gene Summary | Scaffold protein for the de novo synthesis of iron-sulfur (Fe-S) clusters within mitochondria, which is required for maturation of both mitochondrial and cytoplasmic [2Fe-2S] and [4Fe-4S] proteins. First, a [2Fe-2S] cluster is transiently assembled on the scaffold protein ISCU. In a second step, the cluster is released from ISCU, transferred to a glutaredoxin GLRX5, followed by the formation of mitochondrial [2Fe-2S] proteins, the synthesis of [4Fe-4S] clusters and their target-specific insertion into the recipient apoproteins. Cluster assembly on ISCU depends on the function of the cysteine desulfurase complex NFS1-LYRM4/ISD11, which serves as the sulfur donor for cluster synthesis, the iron-binding protein frataxin as the putative iron donor, and the electron transfer chain comprised of ferredoxin reductase and ferredoxin, which receive their electrons from NADH (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG201379 | Iscu (tGFP-tagged) - Mouse IscU iron-sulfur cluster scaffold homolog (E. coli) (Iscu) |
CNY 2850.00 |
|
| MR201379 | Iscu (Myc-DDK-tagged) - Mouse IscU iron-sulfur cluster scaffold homolog (E. coli) (Iscu), nuclear gene encoding mitochondrial protein |
CNY 2400.00 |
|
| MR201379L3 | Lenti ORF clone of Iscu (Myc-DDK-tagged) - Mouse IscU iron-sulfur cluster scaffold homolog (E. coli) (Iscu), nuclear gene encoding mitochondrial protein |
CNY 4750.00 |
|
| MR201379L4 | Lenti ORF clone of Iscu (mGFP-tagged) - Mouse IscU iron-sulfur cluster scaffold homolog (E. coli) (Iscu), nuclear gene encoding mitochondrial protein |
CNY 4750.00 |
