Zfp36l1 (BC016621) Mouse Untagged Clone

CAT#: MC206481

Zfp36l1 (untagged) - Mouse zinc finger protein 36, C3H type-like 1 (cDNA clone MGC:11624 IMAGE:3157001), (10ug)



CNY 3656.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (4)
Zfp36l1 Antibody - C-terminal region
    • 50 ug

CNY 4628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms Brf1, TIS11b, ERF1, cMG1, Berg36
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for BC016621, the custom clone sequence may differ by one or more nucleotides


ATGACCACCACCCTCGTGTCCGCCACCATTTTTGACTTGAGCGAAGTTTTATGCAAGGGTAACAAGATGC
TCAACTACAGCACTCCCAGCGCTGGGGGCTGCCTGCTGGACAGGAAGGCAGTGGGCACCCCTGCTGGCGG
GGGCTTCCCTCGCAGGCACTCGGTCACTCTGCCCAGCTCCAAGTTCCATCAGAACCAGCTTCTCAGCAGC
CTTAAGGGTGAGCCGGCCCCGTCCCTGAGCTCACGCGACAGCCGCTTTCGAGACCGCTCTTTCTCCGAAG
GGGGCGAGCGGCTGCTGCCCACCCAGAAGCAGCCTGGGAGCGGCCAGGTCAACTCCAGCCGCTACAAGAC
GGAGCTGTGCCGTCCCTTCGAAGAAAACGGTGCCTGTAAGTACGGGGACAAGTCCCAGTTCGCGCATGGC
ATCCACGAGCTCCGCAGCCTGACCCGCCACCCCAAGTACAAGACGGAGCTGTGCCGCACCTTCCACACCA
TCGGCTTTTGCCCGTACGGGCCCCGCTGCCACTTCATTCATAACGCCGAGGAGCGACGCGCCCTGGCGGG
GGGCCGAGACCTCTCCGCTGACCGTCCCCGCCTCCAGCATAGCTTTAGCTTTGCTGGGTTTCCCAGTGCC
GCTGCCACCGCCGCTGCCACGGGGCTGCTGGACAGCCCCACATCCATCACCCCACCCCCTATCCTGAGCG
CCGATGACCTCTTGGGCTCACCTACTCTGCCCGATGGCACCAATAACCCCTTCGCCTTTTCCAGCCAGGA
GCTGGCGAGCCTCTTTGCTCCTAGCATGGGGCTGCCTGGGGGAGGCTCCCCCACCACTTTCCTCTTCCGG
CCCATGTCCGAATCCCCTCACATGTTTGACTCTCCCCCCAGCCCTCAGGATTCTCTCTCGGACCACGAGG
GCTATCTGAGCAGCTCCAGCTCCAGCCACAGTGGCTCAGACTCCCCTACCTTGGACAACTCAAGACGCCT
GCCCATTTTCAGCAGACTCTCCATCTCAGATGACTAA


Restriction Sites EcoRI-NotI     
ACCN BC016621
Insert Size 1017 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC016621, AAH16621
RefSeq Size 1967 bp
RefSeq ORF 1017 bp
Locus ID 12192
Gene Summary Zinc-finger RNA-binding protein that destabilizes several cytoplasmic AU-rich element (ARE)-containing mRNA transcripts by promoting their poly(A) tail removal or deadenylation, and hence provide a mechanism for attenuating protein synthesis (PubMed:22701344, PubMed:24700863, PubMed:24733888, PubMed:27102483). Acts as a 3'-untranslated region (UTR) ARE mRNA-binding adapter protein to communicate signaling events to the mRNA decay machinery (By similarity). Functions by recruiting the CCR4-NOT deadenylating complex and components of the cytoplasmic RNA decay machinery to the bound ARE-containing mRNAs, and hence promotes ARE-mediated mRNA deadenylation and decay processes (By similarity). Induces also the degradation of ARE-containing mRNAs even in absence of poly(A) tail (By similarity). Binds to 3' UTR ARE of numerous mRNAs (PubMed:22701344, PubMed:24700863, PubMed:24733888). Positively regulates early adipogenesis by promoting ARE-mediated mRNA decay of immediate early genes (IEGs) (PubMed:22701344). Promotes ARE-mediated mRNA decay of mineralocorticoid receptor NR3C2 mRNA in response to hypertonic stress (PubMed:24700863). Negatively regulates hematopoietic/erythroid cell differentiation by promoting ARE-mediated mRNA decay of the transcription factor STAT5B mRNA (By similarity). Positively regulates monocyte/macrophage cell differentiation by promoting ARE-mediated mRNA decay of the cyclin-dependent kinase CDK6 mRNA (By similarity). Promotes degradation of ARE-containing pluripotency-associated mRNAs in embryonic stem cells (ESCs), such as NANOG, through a fibroblast growth factor (FGF)-induced MAPK-dependent signaling pathway, and hence attenuates ESC self-renewal and positively regulates mesendoderm differentiation (PubMed:24733888). May play a role in mediating pro-apoptotic effects in malignant B-cells by promoting ARE-mediated mRNA decay of BCL2 mRNA (By similarity). In association with ZFP36L2 maintains quiescence on developing B lymphocytes by promoting ARE-mediated decay of several mRNAs encoding cell cycle regulators that help B cells progress through the cell cycle, and hence ensuring accurate variable-diversity-joining (VDJ) recombination and functional immune cell formation (PubMed:27102483). Together with ZFP36L2 is also necessary for thymocyte development and prevention of T-cell acute lymphoblastic leukemia (T-ALL) transformation by promoting ARE-mediated mRNA decay of the oncogenic transcription factor NOTCH1 mRNA (PubMed:20622884). Involved in the delivery of target ARE-mRNAs to processing bodies (PBs) (By similarity). In addition to its cytosolic mRNA-decay function, plays a role in the regulation of nuclear mRNA 3'-end processing; modulates mRNA 3'-end maturation efficiency of the DLL4 mRNA through binding with an ARE embedded in a weak noncanonical polyadenylation (poly(A)) signal in endothelial cells (By similarity). Also involved in the regulation of stress granule (SG) and P-body (PB) formation and fusion (By similarity). Plays a role in vasculogenesis and endocardial development (PubMed:15226444, PubMed:17013884). Involved in the regulation of keratinocyte proliferation, differentiation and apoptosis (By similarity). Plays a role in myoblast cell differentiation (PubMed:17889962).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
Customer Reviews 
Loading...