Polr2k (BC028543) Mouse Untagged Clone
CAT#: MC206567
Polr2k (untagged) - Mouse polymerase (RNA) II (DNA directed) polypeptide K (cDNA clone MGC:41431 IMAGE:3468916), (10ug)
CNY 1200.00
CNY 2000.00
货期*
现货
规格
Product images

推荐一起购买 (3)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | MafY, RPB12, RPABC4, RPB7.0, RPB10alpha |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC028543
CGCTTCTTCCAGCTGTGGAGGCACTAACAATGGACGCTCAGAAAGATGTTCAACCACCAAAGCAGCAGCC AATGATATATATTTGTGGAGAGTGTCACACCGAAAATGAGATAAAGTCCAGGGATCCCATCAGATGCAGA GAATGTGGATACAGAATAATGTACAAGAAAAGGACTAAAAGATTGGTGGTTTTTGATGCTCGATGAAATG TGGGAGTTCAGAAGTATCTTCATTCATACATTTGCCTCATTGATGTTTCTCTTTAATGTATAGCATTTGG CTTAGTTTACTTAATGAAAACAACTGTATGCCTATGATTTCATTTAGAAATACAATTGTATTTTAATACT TTGTATAAAGGAAATTTTGGTTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | EcoRI-NotI |
ACCN | BC028543 |
Insert Size | 177 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC028543, AAH28543 |
RefSeq Size | 480 bp |
RefSeq ORF | 177 bp |
Locus ID | 17749 |
Gene Summary | DNA-dependent RNA polymerase catalyzes the transcription of DNA into RNA using the four ribonucleoside triphosphates as substrates. Common component of RNA polymerases I, II and III which synthesize ribosomal RNA precursors, mRNA precursors and many functional non-coding RNAs, and a small RNAs, such as 5S rRNA and tRNAs, respectively (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG200028 | Polr2k (tGFP-tagged) - Mouse polymerase (RNA) II (DNA directed) polypeptide K (cDNA clone MGC:41431 IMAGE:3468916) |
CNY 2850.00 |
Customer
Reviews
Loading...