Ccl27 (BC028511) Mouse Untagged Clone
CAT#: MC206570
Ccl27 (untagged) - Mouse chemokine (C-C motif) ligand 27 (cDNA clone MGC:41145 IMAGE:3471454), (10ug)
CNY 1200.00
CNY 2000.00
货期*
现货
规格
Product images
推荐一起购买 (3)
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | ALP, mILC, ESkine, CTAK, CTACK, PESKY, ILC |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC028511
GCATGATGGAGGGGCTCTCCCCCGCCAGCAGCCTCCCGCTGTTACTGTTGCTTCTGAGCCCGGCTCCTGA AGCAGCCTTGCCTCTGCCCTCCAGCACTAGCTGCTGTACTCAGCTCTATAGACAGCCACTCCCAAGCAGG CTGCTGAGGAGGATTGTCCACATGGAACTGCAGGAGGCTGATGGGGACTGTCACCTCCAGGCTGTCGTGC TTCACCTGGCTCGGCGCAGTGTCTGTGTTCATCCCCAGAACCGCAGCCTGGCTCGGTGGTTAGAACGCCA AGGGAAAAGGCTCCAAGGAACTGTACCCAGTTTAAATCTGGTACTACAAAAGAAAATGTACTCACACCCC CAACAGCAAAACTAATAAAGCAACATTAGACGACAAAAAAAAAAAAAAAAAA |
| Restriction Sites | EcoRI-NotI |
| ACCN | BC028511 |
| Insert Size | 363 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC028511, AAH28511 |
| RefSeq Size | 402 bp |
| RefSeq ORF | 363 bp |
| Locus ID | 20301 |
| Gene Summary | Chemotactic factor that attracts skin-associated memory T-lymphocytes. May play a role in mediating homing of lymphocytes to cutaneous sites. May play a role in cell migration during embryogenesis. Nuclear forms may facilitate cellular migration by inducing cytoskeletal relaxation. Binds to CCR10.[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Customer
Reviews
Loading...
