Mafg (BC002092) Mouse Untagged Clone

CAT#: MC206838

Mafg (untagged) - Mouse v-maf musculoaponeurotic fibrosarcoma oncogene family, protein G (avian) (cDNA clone MGC:6343 IMAGE:3488374),, (10ug)



  "BC002092" in other vectors (4)

CNY 3230.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-Mafg Antibody
    • 100 ul

CNY 5250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms AA545192; C630022N07Rik
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC206838 representing BC002092.
Blue=ORF Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGACGACCCCCAATAAAGGAAACAAGGCCTTAAAGGTGAAGCGGGAGCCAGGCGAGAATGGCACCAGC
TTGACCGACGAGGAGCTGGTAACCATGTCGGTGCGAGAGTTGAACCAGCACCTGCGAGGCCTCTCCAAG
GAAGAGATCATCCAGCTGAAGCAGCGGAGGCGCACACTGAAGAACCGGGGCTACGCGGCCAGCTGCCGC
GTCAAGCGGGTGACACAGAAGGAGGAGCTGGAGAAGCAGAAGGCGGAGCTCCAGCAGGAGGTGGAGAAG
CTGGCCTCGGAGAATGCCAGCATGAAGCTGGAGCTCGATGCCCTGCGCTCCAAGTACGAGGCCCTGCAG
AACTTTGCCAGGACCGTGGCCCGCAGCCCTGTGGCCCCAGCTCGGGGTCCCCTTGCTGCTGGCCTGGGG
CCCCTGGTTCCTGGCAAGGTGGCTGCCACCAGCGTCATCACAATAGTAAAGTCCAAGACGGATGCTCGG
TCATAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN BC002092
Insert Size 489 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC002092
RefSeq Size 1357 bp
RefSeq ORF 488 bp
Locus ID 17134
MW 17.9 kDa
Gene Summary Since they lack a putative transactivation domain, the small Mafs behave as transcriptional repressors when they dimerize among themselves (PubMed:16738329, PubMed:9679061). However, they seem to serve as transcriptional activators by dimerizing with other (usually larger) basic-zipper proteins, such as NFE2, NFE2L1 and NFE2L2, and recruiting them to specific DNA-binding sites (PubMed:16738329, PubMed:9679061). Small Maf proteins heterodimerize with Fos and may act as competitive repressors of the NFE2L2 transcription factor. Transcription factor, component of erythroid-specific transcription factor NFE2L2. Activates globin gene expression when associated with NFE2L2 (By similarity). May be involved in signal transduction of extracellular H(+) (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...