Naca (BC099375) Mouse Untagged Clone
CAT#: MC206845
Naca (untagged) - Mouse nascent polypeptide-associated complex alpha polypeptide (cDNA clone MGC:117501 IMAGE:30525972), complete, (10ug)
CNY 3230.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | skNAC, mKIAA0363 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC206845 representing BC099375.
Blue=ORF Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCCCGGTGAAGCCACAGAAACCGTCCCTGCTACAGAGCAGGAGTTGCCACAGCCTCAGGCTGAGACA GGATCGGGAACAGAGTCTGACAGTGATGAGTCAGTACCAGAGCTCGAGGAACAAGACTCCACACAGACG GCCACGCAGCAAGCCCAGCTGGCAGCCGCAGCAGAGATCGATGAAGAACCTGTTAGTAAAGCCAAGCAG AGTCGAAGTGAGAAGAAGGCAAGGAAGGCTATGTCCAAACTGGGTCTTCGACAGGTTACAGGGGTTACG AGAGTCACTATCCGAAAATCTAAAAATATCCTCTTTGTCATCACAAAACCCGATGTCTACAAGAGCCCA GCTTCAGACACCTACATAGTGTTTGGGGAAGCCAAGATTGAAGATTTGTCTCAGCAAGCACAGTTAGCA GCTGCTGAGAAATTCAAAGTTCAAGGTGAAGCTGTTTCAAACATTCAGGAAAACACTCAGACTCCAACC GTCCAAGAGGAGAGTGAAGAAGAGGAGGTTGATGAGACGGGTGTGGAAGTTAAGGACATAGAACTGGTC ATGTCGCAAGCAAACGTATCAAGAGCAAAGGCTGTTCGAGCCCTGAAAAACAACAGTAATGATATTGTA AATGCTATTATGGAATTAACAATGTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | BC099375 |
| Insert Size | 648 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC099375 |
| RefSeq Size | 819 bp |
| RefSeq ORF | 647 bp |
| Locus ID | 17938 |
| MW | 23.4 kDa |
| Gene Summary | Prevents inappropriate targeting of non-secretory polypeptides to the endoplasmic reticulum (ER). Binds to nascent polypeptide chains as they emerge from the ribosome and blocks their interaction with the signal recognition particle (SRP), which normally targets nascent secretory peptides to the ER. Also reduces the inherent affinity of ribosomes for protein translocation sites in the ER membrane (M sites) (By similarity). Isoform 1 and isoform 2 appear to bind DNA and play roles in transcription. Isoform 1 may function as a specific coactivator for JUN, acting to stabilize the interaction of JUN homodimers with promoter elements.[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG202378 | Naca (tGFP-tagged) - Mouse nascent polypeptide-associated complex alpha polypeptide (cDNA clone MGC:117501 IMAGE:30525972), complete |
CNY 2850.00 |
|
| MR202378 | Naca (Myc-DDK-tagged) - Mouse nascent polypeptide-associated complex alpha polypeptide (cDNA clone MGC:117501 IMAGE:30525972), complete |
CNY 2400.00 |
|
| MR202378L3 | Lenti ORF clone of Naca (Myc-DDK-tagged) - Mouse nascent polypeptide-associated complex alpha polypeptide (cDNA clone MGC:117501 IMAGE:30525972), complete |
CNY 4750.00 |
|
| MR202378L4 | Lenti ORF clone of Naca (mGFP-tagged) - Mouse nascent polypeptide-associated complex alpha polypeptide (cDNA clone MGC:117501 IMAGE:30525972), complete |
CNY 4750.00 |
