Uxt (BC029258) Mouse Untagged Clone
CAT#: MC206862
Uxt (untagged) - Mouse ubiquitously expressed transcript (cDNA clone MGC:35979 IMAGE:4483276), (10ug)
CNY 3230.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 0910002B17Rik |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC206862 representing BC029258.
Blue=ORF Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCGACGCCCCCGAAACGGCGGGCCTTGGATATGGTGGGGGAGAAAGTGCTGCGGTACGAGACCTTT ATCAGTGACGTACTGCAGCGAGACTTGCAAAAGGTGCTGGATCATCGAGACAAGGTATATGAGCAGCTG TCCGTATATCTTCAACTAAGAAATGTCATTGAGCGACTCCAGGAAACTAATCACTCGGAGTTATATATG CAGGTGGATTTGGGCTGTAACTTCTTCGTTGACACAGTGGTCCCAGATACTTCACGCATCTATGTGGCC CTGGGATATGGTTTTTTCCTGGAACTGACACTGGCTGAAGCACTCAAGTTCATTGACCGAAAGAGTTCT CTCCTCACAGAGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | BC029258 |
| Insert Size | 360 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC029258 |
| RefSeq Size | 701 bp |
| RefSeq ORF | 359 bp |
| Locus ID | 22294 |
| MW | 13.9 kDa |
| Gene Summary | Involved in gene transcription regulation. Acts in concert with the corepressor URI1 to regulate androgen receptor AR-mediated transcription. Together with URI1, associates with chromatin to the NKX3-1 promoter region. Negatively regulates the transcriptional activity of the estrogen receptor ESR1 by inducing its translocation into the cytoplasm. May act as nuclear chaperone that facilitates the formation of the NF-kappa-B enhanceosome and thus positively regulates NF-kappa-B transcription activity. Potential component of mitochondrial-associated LRPPRC, a multidomain organizer that potentially integrates mitochondria and the microtubular cytoskeleton with chromosome remodeling. Increasing concentrations of UXT contributes to progressive aggregation of mitochondria and cell death potentially through its association with LRPPRC. Suppresses cell transformation and it might mediate this function by interaction and inhibition of the biological activity of cell proliferation and survival stimulatory factors like MECOM.[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG200565 | Uxt (tGFP-tagged) - Mouse ubiquitously expressed transcript (cDNA clone MGC:35979 IMAGE:4483276) |
CNY 2850.00 |
|
| MR200565 | Uxt (Myc-DDK-tagged) - Mouse ubiquitously expressed transcript (cDNA clone MGC:35979 IMAGE:4483276) |
CNY 1200.00 |
|
| MR200565L3 | Lenti ORF clone of Uxt (Myc-DDK-tagged) - Mouse ubiquitously expressed transcript (cDNA clone MGC:35979 IMAGE:4483276) |
CNY 4750.00 |
|
| MR200565L4 | Lenti ORF clone of Uxt (mGFP-tagged) - Mouse ubiquitously expressed transcript (cDNA clone MGC:35979 IMAGE:4483276) |
CNY 4750.00 |
