Cartpt (BC056431) Mouse Untagged Clone
CAT#: MC206869
Cartpt (untagged) - Mouse CART prepropeptide (cDNA clone MGC:66635 IMAGE:6817832), (10ug)
CNY 3230.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | Cart |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC206869 representing BC056431.
Blue=ORF Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGAGAGCTCCCGCCTGCGGCTGCTACCCCTCCTGGGCGCCGCCCTGCTGCTACTGCTACCTTTGCTG GGTGCCCGTGCCCAGGAGGACGCCGAGCTGCAGCCCCGAGCCCTGGACATCTACTCTGCCGTGGATGAT GCGTCCCACGAGAAGGAGCTGCCAAGGCGGCAACTTCGGGCTCCCGGCGCTATGTTGCAGATCGAAGCG TTGCAAGAAGTCCTGAAGAAGCTCAAGAGTAAACGCATTCCGATCTACGAGAAGAAGTACGGCCAAGTC CCCATGTGTGACGCTGGAGAGCAGTGCGCAGTGAGGAAAGGGGCCAGGATCGGGAAGCTGTGTGACTGT CCCCGAGGAACTTCCTGCAATTCTTTCCTCTTGAAGTGCTTGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | BC056431 |
Insert Size | 390 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC056431 |
RefSeq Size | 607 bp |
RefSeq ORF | 389 bp |
Locus ID | 27220 |
MW | 14.3 kDa |
Gene Summary | This gene encodes preproprotein isoforms that are processed into multiple biologically active peptides. Expression of this gene is regulated by cocaine and other drugs, and is associated with feeding/appetite and stress response. Mice lacking the encoded protein are predisposed to obesity. Deficiency of the encoded protein in mice results in pancreatic islet dysfunction, impaired insulin secretion and glucose intolerance. Alternative splicing results in multiple transcript variants encoding different isoforms, which are subsequently processed into mature peptides. [provided by RefSeq, Jul 2015] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG200711 | Cartpt (tGFP-tagged) - Mouse CART prepropeptide (cDNA clone MGC:66635 IMAGE:6817832) |
CNY 2850.00 |
|
MR200711 | Cartpt (Myc-DDK-tagged) - Mouse CART prepropeptide (cDNA clone MGC:66635 IMAGE:6817832) |
CNY 1200.00 |
|
MR200711L3 | Lenti ORF clone of Cartpt (Myc-DDK-tagged) - Mouse CART prepropeptide (cDNA clone MGC:66635 IMAGE:6817832) |
CNY 4750.00 |
|
MR200711L4 | Lenti ORF clone of Cartpt (mGFP-tagged) - Mouse CART prepropeptide (cDNA clone MGC:66635 IMAGE:6817832) |
CNY 4750.00 |