Nudt16l1 (BC025569) Mouse Untagged Clone
CAT#: MC206907
Nudt16l1 (untagged) - Mouse nudix (nucleoside diphosphate linked moiety X)-type motif 16-like 1 (cDNA clone MGC:35707 IMAGE:5322456),, (10ug)
CNY 3230.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 1110001K21Rik; 5330437I08Rik; Sdos |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC206907 representing BC025569.
Blue=ORF Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTCGACCACGACGGTTCCGGAGCTGAAACAGATCAGTCGGGAGGAAGCAATGCGCTTGGGGCCCGGC TGGAGTCATTCATGCCACGCCATGCTATACGCCGCCAACCCCGGGCAGCTTTTCGGACGTATCCCCATG CGTTTCTCAGTGCTGATGCAGATGCGCTTCGACGGGCTGCTAGGCTTTCCCGGGGGTTTCGTGGACCGG CGCTTCTGGTCGCTGGAGGATGGCTTGAATCGGGTGCTGGGCCTGGGCCTGGGCGGCCTACGCCTTACC GAAGCTGATTACCTGAGTTCACACCTGACTGAGGGTCCACACCGTGTGGTGGCACATCTGTACGCACGG CAGCTGACATTGGAACAACTGCATGCTGTGGAGATCAGCGCTGTGCACTCACGGGACCACGGTCTGGAG GTGGGGCTACTGCCTGGGGCCCGCCCCCATTCCCACTCCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | BC025569 |
| Insert Size | 456 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC025569 |
| RefSeq Size | 1354 bp |
| RefSeq ORF | 455 bp |
| Locus ID | 66911 |
| MW | 16.7 kDa |
| Gene Summary | Key regulator of TP53BP1 required to stabilize TP53BP1 and regulate its recruitment to chromatin. In absence of DNA damage, interacts with the tandem Tudor-like domain of TP53BP1, masking the region that binds histone H4 dimethylated at 'Lys-20' (H4K20me2), thereby preventing TP53BP1 recruitment to chromatin and maintaining TP53BP1 localization to the nucleus. Following DNA damage, ATM-induced phosphorylation of TP53BP1 and subsequent recruitment of RIF1 leads to dissociate NUDT16L1/TIRR from TP53BP1, unmasking the tandem Tudor-like domain and allowing recruitment of TP53BP1 to DNA double strand breaks (DSBs). Binds U8 snoRNA.[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG201080 | Nudt16l1 (tGFP-tagged) - Mouse nudix (nucleoside diphosphate linked moiety X)-type motif 16-like 1 (cDNA clone MGC:35707 IMAGE:5322456) |
CNY 2850.00 |
|
| MR201080 | Nudt16l1 (Myc-DDK-tagged) - Mouse nudix (nucleoside diphosphate linked moiety X)-type motif 16-like 1 (cDNA clone MGC:35707 IMAGE:5322456) |
CNY 1200.00 |
|
| MR201080L3 | Lenti ORF clone of Nudt16l1 (Myc-DDK-tagged) - Mouse nudix (nucleoside diphosphate linked moiety X)-type motif 16-like 1 (cDNA clone MGC:35707 IMAGE:5322456) |
CNY 4750.00 |
|
| MR201080L4 | Lenti ORF clone of Nudt16l1 (mGFP-tagged) - Mouse nudix (nucleoside diphosphate linked moiety X)-type motif 16-like 1 (cDNA clone MGC:35707 IMAGE:5322456) |
CNY 4750.00 |
其它Nudt16l1产品
