Mesdc2 (BC014742) Mouse Untagged Clone

CAT#: MC206918

Mesdc2 (untagged) - Mouse mesoderm development candiate 2 (cDNA clone MGC:25959 IMAGE:4239248), (10ug)



  "BC014742" in other vectors (4)

CNY 3230.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 2210015O11Rik; AW537813; mesd; mKIAA0081; msd
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC206918 representing BC014742.
Blue=ORF Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCGCGACTTCTGGAGCAGTGGGAGAAAGATGATGACATAGAAGAAGGAGACCTTCCAGAACACAAG
AGACCCTCAGCACCTATCGACTTCTCAAAGCTAGACCCAGGCAAACCTGAGAGCATCTTGAAAATGACA
AAGAAAGGGAAGACTCTGATGATGTTTGTCACCGTGTCTGGGAACCCCACCGAGAAGGAGACAGAGGAG
ATCACCAGCCTGTGGCAGGGTAGCCTGTTCAACGCCAACTATGACGTTCAGAGGTTCATCGTGGGATCC
GACCGCGCCATCTTCATGCTCCGGGATGGGAGCTATGCCTGGGAGATCAAGGACTTTTTGGTCAGTCAA
GACCGGTGTGCTGAAGTCACTCTAGAGGGACAGATGTATCCTGGCAAAGGAGGAGGAAGCAAGGAGAAA
AATAAAACAAAGCCAGAGAAGGCTAAAAAGAAGGAGGGAGATCCCAAACCACGTGCTTCCAAGGAAGAC
AATCGAGCTGGGAGCAGAAGAGAAGACCTTTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN BC014742
Insert Size 516 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC014742
RefSeq Size 1876 bp
RefSeq ORF 515 bp
Locus ID 67943
MW 19.4 kDa
Gene Summary Chaperone specifically assisting the folding of beta-propeller/EGF modules within the family of low-density lipoprotein receptors (LDLRs). Acts as a modulator of the Wnt pathway through chaperoning the coreceptors of the canonical Wnt pathway, LRP5 and LRP6, to the plasma membrane. Essential for specification of embryonic polarity and mesoderm induction (PubMed:12581525). Plays an essential role in neuromuscular junction (NMJ) formation by promoting cell-surface expression of LRP4 (PubMed:24140340). May regulate phagocytosis of apoptotic retinal pigment epithelium (RPE) cells (PubMed:27184668).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...