Ict1 (BC028523) Mouse Untagged Clone
CAT#: MC206924
Ict1 (untagged) - Mouse immature colon carcinoma transcript 1 (cDNA clone MGC:41300 IMAGE:2938122), (10ug)
CNY 2400.00
CNY 3230.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 1110001A02Rik; 1110002E03Rik; MRP-L58 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC206924 representing BC028523.
Blue=ORF Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCGACCGCCTGGGGCCTACGCTGGGGCCTGAGCCGAACTGGAACGTTGTTGCTCGCGCCGCCCGCG CGCTGTGCTCGCCGGGCTCTGCACAGACAGGTAGACGGCACCACGTTCCAGAGCATCTACAGCCTGGAC AAGCTGTACCCCGAGTCCAAGGGCGCGGATACCGCCTGGAAGGTCCCGGAGCATGCAAAACAAGCCAGC AGTTACATCCCTCTGGATCGGTTAAGCATATCTTACTGTCGGAGCAGCGGTCCTGGTGGGCAGAATGTG AACAAAGTGAATTCCAAGGCTGAAGTAAGGTTTCACTTGGCCAGTGCAGACTGGATTGAGGAGCCCGTG CGCCAGAAGATTGCCCTCACGCATAAAAATAAGATCAACAAGGCAGGAGAGCTGGTACTTACCTCTGAG AGCAGCCGGTATCAGTTCCGCAATCTGGCAGAATGCCTACAGAAAATTCGAGACATGATTGCCGAGGCC AGCCAGGTACCCAAAGAGCCATCCAAGGAAGATGCTCGGCTTCAGAGACTCAGGATTGAAAAGATGAAT CGGGAAAGGCTACGACAGAAAAGACTAAACTCTGCCCTAAAGACCAGCAGGAGGATGACTATGGACTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | BC028523 |
| Insert Size | 621 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC028523 |
| RefSeq Size | 879 bp |
| RefSeq ORF | 620 bp |
| Locus ID | 68572 |
| MW | 23.5 kDa |
| Gene Summary | Essential peptidyl-tRNA hydrolase component of the mitochondrial large ribosomal subunit (PubMed:20869366). Acts as a codon-independent translation release factor that has lost all stop codon specificity and directs the termination of translation in mitochondrion, possibly in case of abortive elongation. May be involved in the hydrolysis of peptidyl-tRNAs that have been prematurely terminated and thus in the recycling of stalled mitochondrial ribosomes (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG202185 | Ict1 (tGFP-tagged) - Mouse immature colon carcinoma transcript 1 (cDNA clone MGC:41300 IMAGE:2938122) |
CNY 2850.00 |
|
| MR202185 | Ict1 (Myc-DDK-tagged) - Mouse immature colon carcinoma transcript 1 (cDNA clone MGC:41300 IMAGE:2938122) |
CNY 2400.00 |
|
| MR202185L3 | Lenti ORF clone of Ict1 (Myc-DDK-tagged) - Mouse immature colon carcinoma transcript 1 (cDNA clone MGC:41300 IMAGE:2938122) |
CNY 4750.00 |
|
| MR202185L4 | Lenti ORF clone of Ict1 (mGFP-tagged) - Mouse immature colon carcinoma transcript 1 (cDNA clone MGC:41300 IMAGE:2938122) |
CNY 4750.00 |
