Tspan15 (BC003872) Mouse Untagged Clone
CAT#: MC206938
Tspan15 (untagged) - Mouse tetraspanin 15 (cDNA clone MGC:6632 IMAGE:3492667), (10ug)
CNY 2400.00
CNY 3230.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 1110036D12Rik; 2700063A19Rik; AW048364; Tm4sf15 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for BC003872, the custom clone sequence may differ by one or more nucleotides
ATGCCTCGCGGGGACTCGGAGCAGGTGCGCTACTGCGCGCGCTTCTCCTATCTTTGGCTCAAGTTCTCTC TCATCATCTACTCCACCGTGTTCTGGCTGATTGGGGGCCTGGTCCTGTCGGTGGGGATCTACGCAGAGGC AGAGCGGCAGAAATACAAAACCCTGGAGAGTGCCTTCCTGGCCCCCGCCATTATCCTCATCCTCCTGGGG GTGGTCATGTTCATCGTCTCCTTCATCGGGGTGCTGGCTTCCCTCCGGGACAACCTGTGCCTTCTGCAGT CGTTTATGTATATCCTGGGGATCTGCCTGGTCATGGAGCTGATTGGTGGCATAGTGGCTTTGATCTTCCG GAACCAGACTATTGACTTTCTGAACGACAACATTCGGAGAGGAATCGAGAATTACTACGATGATCTGGAC TTCAAGAACATCATGGACTTTGTTCAGAAGAAGTTCAAGTGCTGTGGCGGGGAGGACTACAGAGACTGGA GCAAAAACCAGTACCACGACTGCAGCGCCCCCGGGCCCCTGGCCTGCGGGGTGCCCTACACCTGCTGCAT CAGGAACACGATGTTGTCAACACCATGTGTGGCTACAAAACAATCGACAAGGAGCGCCTGA |
Restriction Sites | SgfI-MluI |
ACCN | BC003872 |
Insert Size | 621 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC003872, AAH03872 |
RefSeq Size | 1661 bp |
RefSeq ORF | 621 bp |
Locus ID | 70423 |
Gene Summary | Regulates maturation and trafficking of the transmembrane metalloprotease ADAM10 (PubMed:23035126, PubMed:26668317). Promotes ADAM10-mediated cleavage of (CDH2) (PubMed:26668317). Negatively regulates ligand-induced Notch activity probably by regulating ADAM10 activity (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG202186 | Tspan15 (tGFP-tagged) - Mouse tetraspanin 15 (cDNA clone MGC:6632 IMAGE:3492667) |
CNY 2850.00 |
|
MR202186 | Tspan15 (Myc-DDK-tagged) - Mouse tetraspanin 15 (cDNA clone MGC:6632 IMAGE:3492667) |
CNY 2400.00 |
|
MR202186L3 | Lenti ORF clone of Tspan15 (Myc-DDK-tagged) - Mouse tetraspanin 15 (cDNA clone MGC:6632 IMAGE:3492667) |
CNY 4750.00 |
|
MR202186L4 | Lenti ORF clone of Tspan15 (mGFP-tagged) - Mouse tetraspanin 15 (cDNA clone MGC:6632 IMAGE:3492667) |
CNY 4750.00 |
其它Tspan15产品