Nat13 (BC046283) Mouse Untagged Clone
CAT#: MC206945
Nat13 (untagged) - Mouse N-acetyltransferase 13 (cDNA clone MGC:54829 IMAGE:6438976), (10ug)
CNY 3230.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 2600005K24Rik; 2810441M03Rik; AW112078; Mak3; Mak3p; Nat5; Nat13; San |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC206945 representing BC046283.
Blue=ORF Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAAAGGTAGCCGGATCGAGCTGGGAGATGTGACGCCACACAATATTAAACAGTTGAAGAGACTGAAC CAGGTCATCTTTCCAGTCAGCTATAATGATAAATTCTACAAGGATGTGCTAGAGGTTGGCGAGCTAGCA AAACTTGGAACTAAAATGTTAAATCATGTCCTAAACATCTGTGAGAAGGATGGCACTTTTGACAATATC TATCTGCATGTCCAGATCAGCAATGAGTCAGCGATTGACTTTTACCGGAAGTTTGGCTTTGAGATTATC GAGACAAAGAAGAACTACTATAAGAGGATAGAGCCTGCAGACGCGCATGTGCTTCAGAAAAACCTCAAA GTCCCATCTGGTCAGAATGCAGAGACACAGAAGACAGACAACTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | BC046283 |
| Insert Size | 390 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC046283 |
| RefSeq Size | 2187 bp |
| RefSeq ORF | 389 bp |
| Locus ID | 72117 |
| MW | 14.9 kDa |
| Gene Summary | N-alpha-acetyltransferase that acetylates the N-terminus of proteins that retain their initiating methionine. Has a broad substrate specificity: able to acetylate the initiator methionine of most peptides, except for those with a proline in second position. Also displays N-epsilon-acetyltransferase activity by mediating acetylation of the side chain of specific lysines on proteins. Autoacetylates in vivo. The relevance of N-epsilon-acetyltransferase activity is however unclear: able to acetylate H4 in vitro, but this result has not been confirmed in vivo. Component of a N-alpha-acetyltransferase complex containing NAA10 and NAA15, but NAA50 does not influence the acetyltransferase activity of NAA10: this multiprotein complex probably constitutes the major contributor for N-terminal acetylation at the ribosome exit tunnel, with NAA10 acetylating all amino termini that are devoid of methionine and NAA50 acetylating other peptides. Required for sister chromatid cohesion during mitosis by promoting binding of CDCA5/sororin to cohesin: may act by counteracting the function of NAA10.[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG200708 | Nat13 (tGFP-tagged) - Mouse N-acetyltransferase 13 (cDNA clone MGC:54829 IMAGE:6438976) |
CNY 2850.00 |
|
| MR200708 | Nat13 (Myc-DDK-tagged) - Mouse N-acetyltransferase 13 (cDNA clone MGC:54829 IMAGE:6438976) |
CNY 1200.00 |
|
| MR200708L3 | Lenti ORF clone of Nat13 (Myc-DDK-tagged) - Mouse N-acetyltransferase 13 (cDNA clone MGC:54829 IMAGE:6438976) |
CNY 4750.00 |
|
| MR200708L4 | Lenti ORF clone of Nat13 (mGFP-tagged) - Mouse N-acetyltransferase 13 (cDNA clone MGC:54829 IMAGE:6438976) |
CNY 4750.00 |
