Xrcc3 (BC043073) Mouse Untagged Clone
CAT#: MC206951
Xrcc3 (untagged) - Mouse X-ray repair complementing defective repair in Chinese hamster cells 3 (cDNA clone MGC:57978 IMAGE:6404521),, (10ug)
CNY 3230.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC206951 representing BC043073.
Blue=ORF Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGACTTGGATCAGCTGGACCTAAACCCCCGAATTACTGCTGCGGTTAAGAGGGGCAGACTGAAGTCA GTGAAGGAGATTCTGTGCTACTCCGGACCAGACTTGCAGCGGCTCACCGGCCTGCCCAGCCACGATGTG CAGTGCCTGCTGAGAGCTGCCTCTCTACACCTTCGGGGAAGCCGCGTCCTCTCAGCACTGCATCTGTTC CAGCAGAAGGAGAGCTTCCCTGAGCAGCATCAACGCCTGAGCCTAGGCTGCCCTGTCCTGGATCAGTTC CTGGGTGGAGGCCTGCCCCTGGAGGGCATCACTGGCCTGGCTGGCTGCAGCTCAGCAGGAAAGACCCAG CTGGCGCTACAGCTCTGCCTGGCTGTGCAGTTCCCAAGACAATATGGAGGCCTAGAGGCCGGGGCTGTC TACATCTGCACAGAAGATGCCTTCCCCAGCAAGCGGCTGTGGCAGCTCATCGCGCAGCAGCGGAGGCTG CGGACAGACGCGCCTGAGGAGCTGATCGAGAAGATCAGGTTCAGCAACCACATCTTCATTGAACACGCG GCCGACGTGCCCCATTTCGTTGTGAGTTCCACCTTCAGGCCTCAGCCATCAGGGCGAAGCTCCTGCTCT CGCTGGGGGCCACACTGCGAAGACTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | BC043073 |
| Insert Size | 648 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC043073 |
| RefSeq Size | 2318 bp |
| RefSeq ORF | 647 bp |
| Locus ID | 74335 |
| MW | 23.8 kDa |
| Gene Summary | This gene encodes a member of the RecA/Rad51-related protein family that participates in homologous recombination to maintain chromosome stability and repair DNA damage. This gene functionally complements Chinese hamster irs1SF, a repair-deficient mutant that exhibits hypersensitivity to a number of different DNA-damaging agents and is chromosomally unstable. Allelic variants in the human gene are associated with susceptibility to breast cancer and cutaneous malignant melanoma. [provided by RefSeq, Sep 2015] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG202365 | Xrcc3 (tGFP-tagged) - Mouse X-ray repair complementing defective repair in Chinese hamster cells 3 (cDNA clone MGC:57978 IMAGE:6404521) |
CNY 2850.00 |
|
| MR202365 | Xrcc3 (Myc-DDK-tagged) - Mouse X-ray repair complementing defective repair in Chinese hamster cells 3 (cDNA clone MGC:57978 IMAGE:6404521) |
CNY 2400.00 |
|
| MR202365L3 | Lenti ORF clone of Xrcc3 (Myc-DDK-tagged) - Mouse X-ray repair complementing defective repair in Chinese hamster cells 3 (cDNA clone MGC:57978 IMAGE:6404521) |
CNY 4750.00 |
|
| MR202365L4 | Lenti ORF clone of Xrcc3 (mGFP-tagged) - Mouse X-ray repair complementing defective repair in Chinese hamster cells 3 (cDNA clone MGC:57978 IMAGE:6404521) |
CNY 4750.00 |
