Commd7 (NM_001195390) Mouse Untagged Clone
CAT#: MC206966
Commd7 (untagged) - Mouse COMM domain containing 7 (Commd7), transcript variant 2, (10ug)
CNY 3230.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 2310010I22Rik; AW060956; mU3 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC206966 representing NM_001195390.
Blue=ORF Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAAAAGCCTCCTACTGGTTCCAAATGGTGCACTGAAGAAAGGCCTCACTGCCGAGCAGGTGCGGACT GATCTCCAGACGCTAGGTCTTAGCGAGGAGAAAGCCACTTACTTTTCTGAAAAGTGGAAGCAGAACGCC TCGACCCTTGCACAGTGGGCCATGGGTCAGACCCTGATGGTTAACCAGCTGATTGATATGGAGTGGAGG TTTGGAGTGACGTCTGGGAGCAGTGAATTAGAGAAAGTGGGAAGCATATTTTTACAGTTAAAGTTGGTG GTTAAGAAAGGAAAACAAACTGAAAATTTGTATATGGAACTAACCTTGCCCCAGTTCTACAGCTTCCTG CACGAGATGGAGAGAGTCCGAGCGAGCATGGAGTGCCTCAGCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001195390 |
Insert Size | 390 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001195390.1 |
RefSeq Size | 3288 bp |
RefSeq ORF | 390 bp |
Locus ID | 99311 |
UniProt ID | Q8BG94 |
MW | 14.7 kDa |
Gene Summary | May modulate activity of cullin-RING E3 ubiquitin ligase (CRL) complexes. Associates with the NF-kappa-B complex and suppresses its transcriptional activity.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) differs in its 5' UTR and uses a downstream start codon, compared to variant 1. The encoded isoform (2) is shorter at the N-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR202034 | Commd7 (Myc-DDK-tagged) - Mouse COMM domain containing 7 (Commd7), transcript variant 2 |
CNY 2400.00 |
|
MR202034L3 | Lenti ORF clone of Commd7 (Myc-DDK-tagged) - Mouse COMM domain containing 7 (Commd7), transcript variant 2 |
CNY 4750.00 |
|
MR202034L4 | Lenti ORF clone of Commd7 (mGFP-tagged) - Mouse COMM domain containing 7 (Commd7), transcript variant 2 |
CNY 4750.00 |