Bnip3l (NM_009761) Mouse Untagged Clone
CAT#: MC207240
Bnip3l (untagged) - Mouse BCL2/adenovirus E1B interacting protein 3-like (Bnip3l), (10ug)
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | C86132; D14Ertd719e; Nip3L; Nix |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC207240 representing NM_009761
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTCTCACTTAGTCGAGCCGCCGCCGCCCTTGCACAACAACAACAACAACTGCGAGGAAGGGGAGCAGC CCCTGCCGCCGCCCGCTGGCCTCAACAGTTCCTGGGTGGAGCTACCCATGAACAGCAGCAATGGCAATGA GAATGGAAATGGGAAGAATGGGGGGCTGGAGCACGTTCCTTCCTCGTCTTCCATCCACAATGGAGACATG GAGAAGATCCTCCTGGATGCACAGCATGAGTCGGGACAGAGCAGCTCAAGAGGCAGTTCGCACTGTGACA GCCCTTCACCACAAGAAGATGGGCAGATCATGTTTGATGTTGAGATGCATACCAGCAGGGACCACAGCTC TCAGTCAGAAGAAGAAGTTGTAGAAGGAGAAAAGGAAGTTGAGGCTTTGAAGAAAAGTGCAGACTGGGTA TCAGACTGGTCCAGTAGACCCGAAAACATCCCACCCAAAGAGTTCCATTTCAGACACCCTAAACGTGCTG CGTCTCTAAGCATGAGGAAGAGTGGAGCCATGAAGAAAGGGGGCATTTTCTCTGCAGAGTTCCTAAAAGT TTTCATCCCATCTCTCTTCCTTTCTCATGTGCTGGCCTTGGGGCTCGGCATCTATATTGGAAAACGACTG AGCACACCTTCTGCCAGCACCTACTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_009761 |
| Insert Size | 657 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_009761.3, NP_033891.1 |
| RefSeq Size | 3237 bp |
| RefSeq ORF | 657 bp |
| Locus ID | 12177 |
| UniProt ID | Q9Z2F7 |
| Gene Summary | Induces apoptosis. Interacts with viral and cellular anti-apoptosis proteins. Can overcome the suppressors BCL-2 and BCL-XL, although high levels of BCL-XL expression will inhibit apoptosis. Inhibits apoptosis induced by BNIP3. Involved in mitochondrial quality control via its interaction with SPATA18/MIEAP: in response to mitochondrial damage, participates in mitochondrial protein catabolic process (also named MALM) leading to the degradation of damaged proteins inside mitochondria. The physical interaction of SPATA18/MIEAP, BNIP3 and BNIP3L/NIX at the mitochondrial outer membrane regulates the opening of a pore in the mitochondrial double membrane in order to mediate the translocation of lysosomal proteins from the cytoplasm to the mitochondrial matrix (By similarity). May function as a tumor suppressor (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG202460 | Bnip3l (tGFP-tagged) - Mouse BCL2/adenovirus E1B interacting protein 3-like (Bnip3l) |
CNY 4370.00 |
|
| MR202460 | Bnip3l (Myc-DDK-tagged) - Mouse BCL2/adenovirus E1B interacting protein 3-like (Bnip3l) |
CNY 3600.00 |
|
| MR202460L3 | Lenti ORF clone of Bnip3l (Myc-DDK-tagged) - Mouse BCL2/adenovirus E1B interacting protein 3-like (Bnip3l) |
CNY 5890.00 |
|
| MR202460L4 | Lenti ORF clone of Bnip3l (mGFP-tagged) - Mouse BCL2/adenovirus E1B interacting protein 3-like (Bnip3l) |
CNY 6000.00 |
