Cd3d (NM_013487) Mouse Untagged Clone

CAT#: MC207244

Cd3d (untagged) - Mouse CD3 antigen, delta polypeptide (Cd3d), (10ug)



  "NM_013487" in other vectors (4)

CNY 3990.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms T3d
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC207244 representing NM_013487
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAACACAGCGGGATTCTGGCTAGTCTGATACTGATTGCTGTTCTCCCCCAAGGGAGCCCCTTCAAGA
TACAAGTGACCGAATATGAGGACAAAGTATTTGTGACCTGCAATACCAGCGTCATGCATCTAGATGGAAC
GGTGGAAGGATGGTTTGCAAAGAATAAAACACTCAACTTGGGCAAAGGCGTTCTGGACCCACGAGGGATA
TATCTGTGTAATGGGACAGAGCAGCTGGCAAAGGTGGTGTCTTCTGTGCAAGTCCATTACCGAATGTGCC
AGAACTGTGTGGAGCTAGACTCGGGCACCATGGCTGGTGTCATCTTCATTGACCTCATCGCAACTCTGCT
CCTGGCTTTGGGCGTCTACTGCTTTGCAGGACATGAGACCGGAAGGCCTTCTGGGGCTGCTGAGGTTCAA
GCACTGCTGAAGAATGAGCAGCTGTATCAGCCTCTTCGAGATCGTGAAGATACCCAGTACAGCCGTCTTG
GAGGGAACTGGCCCCGGAACAAGAAATCTTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_013487
Insert Size 522 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_013487.3, NP_038515.3
RefSeq Size 1330 bp
RefSeq ORF 522 bp
Locus ID 12500
UniProt ID P04235
Gene Summary Part of the TCR-CD3 complex present on T-lymphocyte cell surface that plays an essential role in adaptive immune response. When antigen presenting cells (APCs) activate T-cell receptor (TCR), TCR-mediated signals are transmitted across the cell membrane by the CD3 chains CD3D, CD3E, CD3G and CD3Z. All CD3 chains contain immunoreceptor tyrosine-based activation motifs (ITAMs) in their cytoplasmic domain. Upon TCR engagement, these motifs become phosphorylated by Src family protein tyrosine kinases LCK and FYN, resulting in the activation of downstream signaling pathways. In addition of this role of signal transduction in T-cell activation, CD3D plays an essential role in thymocyte differentiation. Indeed, participates in correct intracellular TCR-CD3 complex assembly and surface expression. In absence of a functional TCR-CD3 complex, thymocytes are unable to differentiate properly (PubMed:10935641). Interacts with CD4 and CD8 and thus serves to establish a functional link between the TCR and coreceptors CD4 and CD8, which is needed for activation and positive selection of CD4 or CD8 T-cells.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...