Ctla2a (NM_001145799) Mouse Untagged Clone
CAT＃: MC207255
Ctla2a (untagged) - Mouse cytotoxic T lymphocyte-associated protein 2 alpha (Ctla2a), transcript variant 2, (10ug)
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | Ctla-2a |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC207255 representing NM_001145799
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGATGTCAGCTGCTCCACCCCCTGATCCAAGTTTGGATAATGAGTGGAAAGAATGGAAGACGAAATTTG CAAAAGCCTACAATCTGAATGAAGAAAGACACAGAAGACTCGTGTGGGAGGAGAATAAGAAGAAAATTGA GGCACACAATGCAGACTATGAGCAGGGCAAGACCAGCTTCTACATGGGCCTGAATCAATTTAGTGACTTG ACTCCAGAAGAATTCAAGACAAATTGCTATGGAAACTCACTGAATAGAGGAGAAATGGCTCCTGATTTGC CTGAATATGAAGATTTGGGAAAGAACAGCTATCTGACACCTGGAAGGGCTCAGCCAGAGTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001145799 |
| Insert Size | 342 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001145799.1, NP_001139271.1 |
| RefSeq Size | 1335 bp |
| RefSeq ORF | 342 bp |
| Locus ID | 13024 |
| Gene Summary | Not known, expressed in activated T-cell.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) differs in the 5' UTR and uses an downstream translational start codon, compared to variant 1. The resulting isoform (b) is shorter at the N-terminus, compared to isoform a. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MR200830 | Ctla2a (Myc-DDK-tagged) - Mouse cytotoxic T lymphocyte-associated protein 2 alpha (Ctla2a), transcript variant 2 |
CNY 1200.00 |
|
| MR200830L3 | Lenti ORF clone of Ctla2a (Myc-DDK-tagged) - Mouse cytotoxic T lymphocyte-associated protein 2 alpha (Ctla2a), transcript variant 2 |
CNY 4750.00 |
|
| MR200830L4 | Lenti ORF clone of Ctla2a (mGFP-tagged) - Mouse cytotoxic T lymphocyte-associated protein 2 alpha (Ctla2a), transcript variant 2 |
CNY 4750.00 |
