Kcnmb1 (NM_031169) Mouse Untagged Clone
CAT#: MC207312
Kcnmb1 (untagged) - Mouse potassium large conductance calcium-activated channel, subfamily M, beta member 1 (Kcnmb1), (10ug)
CNY 2400.00
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | BKbeta1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC207312 representing NM_031169
Red=Cloning site Blue=ORF TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGGGAAGAAGCTGGTGATGGCCCAGAAGCGCGGAGAGACACGAGCCCTCTGCCTGGGAGTGGCAATGG TAGTGTGTGCTGCCATCACCTACTACGTCCTGGGTACAACTGTGCTGCCCCTCTACCAGAAAAGTGTGTG GACCCAGGAATCCATATGTCACTTGATTGAAACTAATATCAAGGACCAGGAAGAGCTGGAGGGCAAGAAG GTGCCCCAGTACCCATGCCTTTGGGTCAATGTATCAGCTGTGGGCAGATGGGCCATGCTGTATCACACGG AAGACACTCGGGATCAAAACCAACAGTGCTCCTATATCCCCAGGAACCTGGACAACTACCAGACAGCCTT GGCAGATGTGAAGAAGGTCAGAGCCAATTTCTATAAGCACCATGAATTCTATTGCCTTTCTGCACCTCAA GTCAACGAGACCAGCGTCGTGTACCAGCGCCTCTACGGGCCCCAAGTCCTCCTCTTCTCCTTCTTCTGGC CCACCTTCCTGCTGACTGGGGGTCTTCTTCTTATTGCCATGGTGAAGCTCAACAGGTCCCTATCCATCTT GGCAGCTCAGAAGTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_031169 |
Insert Size | 576 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC013338, AAH13338 |
RefSeq Size | 1199 bp |
RefSeq ORF | 576 bp |
Locus ID | 16533 |
UniProt ID | Q8CAE3 |
Gene Summary | Regulatory subunit of the calcium activated potassium KCNMA1 (maxiK) channel. Modulates the calcium sensitivity and gating kinetics of KCNMA1, thereby contributing to KCNMA1 channel diversity. Increases the apparent Ca(2+)/voltage sensitivity of the KCNMA1 channel. It also modifies KCNMA1 channel kinetics and alters its pharmacological properties. It slows down the activation and the deactivation kinetics of the channel. Acts as a negative regulator of smooth muscle contraction by enhancing the calcium sensitivity to KCNMA1. Its presence is also a requirement for internal binding of the KCNMA1 channel opener dehydrosoyasaponin I (DHS-1) triterpene glycoside and for external binding of the agonist hormone 17-beta-estradiol (E2). Increases the binding activity of charybdotoxin (CTX) toxin to KCNMA1 peptide blocker by increasing the CTX association rate and decreasing the dissociation rate.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG201831 | Kcnmb1 (tGFP-tagged) - Mouse potassium large conductance calcium-activated channel, subfamily M, beta member 1 (Kcnmb1) |
CNY 2850.00 |
|
MR201831 | Kcnmb1 (Myc-DDK-tagged) - Mouse potassium large conductance calcium-activated channel, subfamily M, beta member 1 (Kcnmb1) |
CNY 2400.00 |
|
MR201831L3 | Lenti ORF clone of Kcnmb1 (Myc-DDK-tagged) - Mouse potassium large conductance calcium-activated channel, subfamily M, beta member 1 (Kcnmb1) |
CNY 4750.00 |
|
MR201831L4 | Lenti ORF clone of Kcnmb1 (mGFP-tagged) - Mouse potassium large conductance calcium-activated channel, subfamily M, beta member 1 (Kcnmb1) |
CNY 4750.00 |