Siva1 (NM_013929) Mouse Untagged Clone

CAT#: MC207482

Siva1 (untagged) - Mouse SIVA1, apoptosis-inducing factor (Siva1), transcript variant 1, (10ug)



  "NM_013929" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms CD27bp; Siva
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC207482 representing NM_013929
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCCCAAGCGGAGCTGCCCGTTCGCAGACGCAGCCCCGCTCCAACTCAAAGTCCACGTGGGCCTGAAAG
AGCTGAGCCACGGTGTGTTCGCCGAGCGCTACTCACGCGAGGTCTTCGAAAGAACCAAGCAGCTCCTTTT
CCAAGGGGCTCGGGCCTATAGAGATCACATATCGAGCGAAGATTGTTCCGTGAACCACCTGCAGGAGTCA
CTGAAGTCTGGTGTGGTAGGAGCCCCTCAACCTGCGAGGGGACAGATGTTGATTGGACCTGATGGCCGAC
TGACACGGTGCCAAGCTCAGGCCTCAGAAGGTGGCCTTCCCAGGACAGCGCCCATCGCTTGTTCATCGTG
CATGAGATCTGTGGATGGGAAGGCGGTCTGCAGCCAGTGCGAGCGGGCCCTGTGTGGGCAGTGTGTATAC
ACCTGCTGGGGCTGCGGTGCTTTGGCCTGTGTGCTGTGTGGCCTTGCAGACTATGCCGACGATGGTGAGA
AGACACTGTGCACCAGCTGTGCTATGTTTGAAGCCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_013929
Insert Size 528 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_013929.2, NP_038957.2
RefSeq Size 782 bp
RefSeq ORF 528 bp
Locus ID 30954
UniProt ID O54926
Gene Summary Induces CD27-mediated apoptosis. Inhibits BCL2L1 isoform Bcl-x(L) anti-apoptotic activity. Inhibits activation of NF-kappa-B and promotes T-cell receptor-mediated apoptosis (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...