Cbx7 (NM_144811) Mouse Untagged Clone
CAT#: MC207495
Cbx7 (untagged) - Mouse chromobox homolog 7 (Cbx7), (10ug)
CNY 1200.00
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 1600014J01Rik; AI851678; D15Ertd417e |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_144811, the custom clone sequence may differ by one or more nucleotides
ATGGAGCTGTCAGCCATAGGCGAGCAGGTGTTTGCGGTGGAGAGCATCCGGAAGAAGCGCGTGCGGAAGG GCAAAGTTGAATATCTGGTGAAGTGGAAAGGATGGCCCCCCAAGTATAGCACCTGGGAGCCAGAGGAGCA CATCTTGGACCCTCGCCTTGTCATGGCCTACGAGGAGAAGGAGGAGAGAGACCGAGCCTCGGGGTATAGG AAGAGAGGTCCGAAACCCAGGCGGCTTCTGCTACAGGAGTCAGCAGCCCCAGACGTTGTGCAGACCCCCG GAGACTGGGAGCCTATGGAGCAAGCCCCCGAGGAGGAGGCAGAAGCAGACCTGACCAATGGGCCGCCTCC CTGGACACCCACGCTCCCCTCAAGTGAAGTTACCGTGACTGACATCACCGCCAACTCCGTCACCGTCACC TTCCGCGAGGCTCAAGCCGCCGAGGGCTTCTTCCGAGACCGCAACGAGAAGCTGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_144811 |
Insert Size | 477 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC021398, AAH21398 |
RefSeq Size | 1520 bp |
RefSeq ORF | 477 bp |
Locus ID | 52609 |
UniProt ID | Q8VDS3 |
Gene Summary | Component of a Polycomb group (PcG) multiprotein PRC1-like complex, a complex class required to maintain the transcriptionally repressive state of many genes, including Hox genes, throughout development (PubMed:16537902, PubMed:22226355). PcG PRC1 complex acts via chromatin remodeling and modification of histones; it mediates monoubiquitination of histone H2A 'Lys-119', rendering chromatin heritably changed in its expressibility. Promotes histone H3 trimethylation at 'Lys-9' (H3K9me3) (By similarity). Binds to histone H3 trimethylated at 'Lys-9' (H3K9me3) or at 'Lys-27' (H3K27me3) (PubMed:16537902, PubMed:22226355). Trimethylation at 'Lys-27' (H3K27me3) is important for chromatin recruitment (PubMed:22226355, PubMed:16537902). May possibly also bind trimethylated lysine residues in other proteins (in vitro) (PubMed:16537902). Binds non-coding, single-stranded RNA and double-stranded RNA (PubMed:20541999, PubMed:16537902). Plays a role in the timely repression of differentiation-specific genes in pluripotent embryonic stem cells to maintain the undifferentiated state (PubMed:22226355). Regulator of cellular lifespan by maintaining the repression of CDKN2A, but not by inducing telomerase activity (PubMed:14647293).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG201190 | Cbx7 (tGFP-tagged) - Mouse chromobox homolog 7 (Cbx7) |
CNY 2850.00 |
|
MR201190 | Cbx7 (Myc-DDK-tagged) - Mouse chromobox homolog 7 (Cbx7) |
CNY 1200.00 |
|
MR201190L3 | Lenti ORF clone of Cbx7 (Myc-DDK-tagged) - Mouse chromobox homolog 7 (Cbx7) |
CNY 4750.00 |
|
MR201190L4 | Lenti ORF clone of Cbx7 (mGFP-tagged) - Mouse chromobox homolog 7 (Cbx7) |
CNY 4750.00 |