Rybp (NM_019743) Mouse Untagged Clone
CAT#: MC207520
Rybp (untagged) - Mouse RING1 and YY1 binding protein (Rybp), (10ug)
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 2410018J24Rik; DEDAF; YEAF1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC207520 representing NM_019743
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGACCATGGGCGACAAGAAGAGCCCGACCAGGCCAAAAAGACAAGCGAAACCTGCCGCAGACGAAGGCT TTTGGGATTGTAGCGTCTGCACCTTTAGGAACAGCGCCGAAGCCTTTAAATGCAGCATCTGCGATGTGCG GAAAGGCACCTCCACCAGGAAACCTCGCATCAATTCTCAGCTGGTGGCACAGCAGGTGGCACAGCAGTAC GCCACTCCACCTCCCCCTAAGAAGGAGAAGAAGGAGAAGGTCGAAAAGCCTGACAAAGAAAAGCCAGAGA AAGACAAGGACATTAGCCCCAGTGTCACCAAGAAAAACACCAACAAGAAAACAAAACCAAAGTCTGATAT TCTGAAAGATCCTCCTAGTGAAGCTAACAGCATACAGTCTGCTAACGCTACAACAAAGACCAGCGAAACA AACCACACCTCAAGGCCCCGGCTGAAGAATGTGGACAGGAGCACCGCACAGCAGTTGGCAGTAACTGTGG GCAACGTCACCGTCATTATCACAGACTTTAAGGAAAAGACTCGCTCCTCCTCCACATCCTCTTCCACAGT GACCTCCAGTGCAGGGTCAGAACAGCAGAACCAGAGCAGCTCGGGCTCAGAGAGCACAGACAAAGGCTCC TCCCGCTCCTCCACGCCAAAGGGCGACATGTCAGCAGTGAATGATGAATCTTTCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_019743 |
Insert Size | 687 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_019743.3, NP_062717.2 |
RefSeq Size | 4376 bp |
RefSeq ORF | 687 bp |
Locus ID | 56353 |
UniProt ID | Q8CCI5 |
Gene Summary | Component of a Polycomb group (PcG) multiprotein PRC1-like complex, a complex class required to maintain the transcriptionally repressive state of many genes, including Hox genes, throughout development. PcG PRC1-like complex acts via chromatin remodeling and modification of histones; it mediates monoubiquitination of histone H2A 'Lys-119', rendering chromatin heritably changed in its expressibility (PubMed:22325148, PubMed:28596365). Component of a PRC1-like complex that mediates monoubiquitination of histone H2A 'Lys-119' on the X chromosome and is required for normal silencing of one copy of the X chromosome in XX females (PubMed:28596365). May stimulate ubiquitination of histone H2A 'Lys-119' by recruiting the complex to target sites (PubMed:22325148, PubMed:28596365). Inhibits ubiquitination and subsequent degradation of TP53, and thereby plays a role in regulating transcription of TP53 target genes (By similarity). May also regulate the ubiquitin-mediated proteasomal degradation of other proteins like FANK1 to regulate apoptosis (PubMed:17874297). May be implicated in the regulation of the transcription as a repressor of the transcriptional activity of E4TF1 (By similarity). May bind to DNA (PubMed:19170609). May play a role in the repression of tumor growth and metastasis in breast cancer by down-regulating SRRM3 (PubMed:27748911).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG202718 | Rybp (tGFP-tagged) - Mouse RING1 and YY1 binding protein (Rybp) |
CNY 2850.00 |
|
MR202718 | Rybp (Myc-DDK-tagged) - Mouse RING1 and YY1 binding protein (Rybp) |
CNY 2400.00 |
|
MR202718L3 | Lenti ORF clone of Rybp (Myc-DDK-tagged) - Mouse RING1 and YY1 binding protein (Rybp) |
CNY 4750.00 |
|
MR202718L4 | Lenti ORF clone of Rybp (mGFP-tagged) - Mouse RING1 and YY1 binding protein (Rybp) |
CNY 4750.00 |