Rybp (NM_019743) Mouse Untagged Clone

CAT#: MC207520

Rybp (untagged) - Mouse RING1 and YY1 binding protein (Rybp), (10ug)



  "NM_019743" in other vectors (4)

CNY 3990.00


货期*
5周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rybp Antibody - N-terminal region
    • 50 ug

CNY 4628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 2410018J24Rik; DEDAF; YEAF1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC207520 representing NM_019743
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGACCATGGGCGACAAGAAGAGCCCGACCAGGCCAAAAAGACAAGCGAAACCTGCCGCAGACGAAGGCT
TTTGGGATTGTAGCGTCTGCACCTTTAGGAACAGCGCCGAAGCCTTTAAATGCAGCATCTGCGATGTGCG
GAAAGGCACCTCCACCAGGAAACCTCGCATCAATTCTCAGCTGGTGGCACAGCAGGTGGCACAGCAGTAC
GCCACTCCACCTCCCCCTAAGAAGGAGAAGAAGGAGAAGGTCGAAAAGCCTGACAAAGAAAAGCCAGAGA
AAGACAAGGACATTAGCCCCAGTGTCACCAAGAAAAACACCAACAAGAAAACAAAACCAAAGTCTGATAT
TCTGAAAGATCCTCCTAGTGAAGCTAACAGCATACAGTCTGCTAACGCTACAACAAAGACCAGCGAAACA
AACCACACCTCAAGGCCCCGGCTGAAGAATGTGGACAGGAGCACCGCACAGCAGTTGGCAGTAACTGTGG
GCAACGTCACCGTCATTATCACAGACTTTAAGGAAAAGACTCGCTCCTCCTCCACATCCTCTTCCACAGT
GACCTCCAGTGCAGGGTCAGAACAGCAGAACCAGAGCAGCTCGGGCTCAGAGAGCACAGACAAAGGCTCC
TCCCGCTCCTCCACGCCAAAGGGCGACATGTCAGCAGTGAATGATGAATCTTTCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_019743
Insert Size 687 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_019743.3, NP_062717.2
RefSeq Size 4376 bp
RefSeq ORF 687 bp
Locus ID 56353
UniProt ID Q8CCI5
Gene Summary Component of a Polycomb group (PcG) multiprotein PRC1-like complex, a complex class required to maintain the transcriptionally repressive state of many genes, including Hox genes, throughout development. PcG PRC1-like complex acts via chromatin remodeling and modification of histones; it mediates monoubiquitination of histone H2A 'Lys-119', rendering chromatin heritably changed in its expressibility (PubMed:22325148, PubMed:28596365). Component of a PRC1-like complex that mediates monoubiquitination of histone H2A 'Lys-119' on the X chromosome and is required for normal silencing of one copy of the X chromosome in XX females (PubMed:28596365). May stimulate ubiquitination of histone H2A 'Lys-119' by recruiting the complex to target sites (PubMed:22325148, PubMed:28596365). Inhibits ubiquitination and subsequent degradation of TP53, and thereby plays a role in regulating transcription of TP53 target genes (By similarity). May also regulate the ubiquitin-mediated proteasomal degradation of other proteins like FANK1 to regulate apoptosis (PubMed:17874297). May be implicated in the regulation of the transcription as a repressor of the transcriptional activity of E4TF1 (By similarity). May bind to DNA (PubMed:19170609). May play a role in the repression of tumor growth and metastasis in breast cancer by down-regulating SRRM3 (PubMed:27748911).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...