Actl6a (NM_019673) Mouse Untagged Clone
CAT＃: MC207524
Actl6a (untagged) - Mouse actin-like 6A (Actl6a), (10ug)
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 2810432C06Rik; Actl6; AI851094; ARP4; Baf53a; C79802 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC207524 representing NM_019673
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAGCGGCGGCGTGTACGGCGGAGATGAAGTTGGCGCTCTTGTTTTTGACATTGGATCGTACACAGTGA GGGCTGGCTATGCTGGCGAGGACTGCCCTAAGGTTGATTTCCCCACGGCTATCGGTGTGGTGCTGGAGAG AGATGACGGAAGTACAATGATGGAGATTGATGGTGACAAAGGCAAGCAGGGCGGGCCCACCTACTACATA GACACCAATGCCCTCCGCGTGCCCAGGGAGAACATGGAGGCCATCTCACCACTCAAGAATGGCATGGTTG AAGACTGGGATAGTTTCCAGGCCATTTTGGATCATACATACAAGATGCATGTCAAATCCGAAGCCAGCCT GCATCCTGTTCTCATGTCGGAAGCACCGTGGAACACCAGGGCGAAGAGAGAGAAACTGACAGAGTTGATG TTTGAGCACTACAGCATCCCTGCATTCTTCCTTTGCAAAACTGCAGTTTTGACGGCATTTGCTAATGGTC GTTCTACTGGGCTGATTTTGGACAGTGGAGCTACCCACACCACTGCGATTCCAGTCCACGATGGCTATGT TCTTCAACAAGGCATTGTGAAATCCCCTCTGGCTGGAGACTTCATTACCATGCAGTGCAGAGAACTCTTC CAGGAAATGAACATAGAACTCATTCCTCCTTACATGATTGCATCAAAAGAGGCTGTTCGAGAAGGTTCTC CAGCCAACTGGAAAAGAAAAGAGAAACTGCCCCAGGTTACAAGGTCTTGGCACAATTACATGTGCAACTG CGTCATCCAGGATTTTCAAGCTTCCGTTCTTCAGGTGTCAGACTCCACCTACGACGAACAAGTGGCTGCA CAGATGCCAACCGTCCACTACGAATTCCCCAATGGCTACAACTGTGATTTTGGGGCAGAGCGGCTGAAAA TTCCTGAAGGGTTATTTGACCCTTCCAACGTAAAGGGACTGTCTGGGAACACGATGCTGGGAGTCAGTCA CGTTGTCACAACCAGCGTCGGAATGTGTGACATCGACATCAGACCAGGTCTCTACGGCAGTGTGATCGTA GCAGGAGGAAACACGCTAATACAGAGTTTCACTGACAGGTTAAATAGAGAGCTTTCTCAGAAAACTCCAC CAAGTATGCGGTTGAAACTGATTGCAAACAACACGACGGTGGAGCGGAGGTTCAGCTCATGGATTGGTGG CTCTATCCTAGCATCTTTGGGTACCTTTCAACAGATGTGGATTTCTAAACAGGAATATGAAGAAGGAGGG AAGCAGTGTGTAGAAAGAAAATGCCCTTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_019673 |
| Insert Size | 1290 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_019673.2, NP_062647.2 |
| RefSeq Size | 1969 bp |
| RefSeq ORF | 1290 bp |
| Locus ID | 56456 |
| UniProt ID | Q9Z2N8 |
| Gene Summary | Involved in transcriptional activation and repression of select genes by chromatin remodeling (alteration of DNA-nucleosome topology). Component of SWI/SNF chromatin remodeling complexes that carry out key enzymatic activities, changing chromatin structure by altering DNA-histone contacts within a nucleosome in an ATP-dependent manner. Required for maximal ATPase activity of SMARCA4/BRG1/BAF190A and for association of the SMARCA4/BRG1/BAF190A containing remodeling complex BAF with chromatin/nuclear matrix. Belongs to the neural progenitors-specific chromatin remodeling complex (npBAF complex) and is required for the proliferation of neural progenitors. During neural development a switch from a stem/progenitor to a postmitotic chromatin remodeling mechanism occurs as neurons exit the cell cycle and become committed to their adult state. The transition from proliferating neural stem/progenitor cells to postmitotic neurons requires a switch in subunit composition of the npBAF and nBAF complexes. As neural progenitors exit mitosis and differentiate into neurons, npBAF complexes which contain ACTL6A/BAF53A and PHF10/BAF45A, are exchanged for homologous alternative ACTL6B/BAF53B and DPF1/BAF45B or DPF3/BAF45C subunits in neuron-specific complexes (nBAF). The npBAF complex is essential for the self-renewal/proliferative capacity of the multipotent neural stem cells. The nBAF complex along with CREST plays a role regulating the activity of genes essential for dendrite growth (PubMed:17640523). Component of the NuA4 histone acetyltransferase (HAT) complex which is involved in transcriptional activation of select genes principally by acetylation of nucleosomal histones H4 and H2A. This modification may both alter nucleosome - DNA interactions and promote interaction of the modified histones with other proteins which positively regulate transcription. This complex may be required for the activation of transcriptional programs associated with oncogene and proto-oncogene mediated growth induction, tumor suppressor mediated growth arrest and replicative senescence, apoptosis, and DNA repair. NuA4 may also play a direct role in DNA repair when recruited to sites of DNA damage. Putative core component of the chromatin remodeling INO80 complex which is involved in transcriptional regulation, DNA replication and probably DNA repair (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG206846 | Actl6a (tGFP-tagged) - Mouse actin-like 6A (Actl6a) |
CNY 5256.00 |
|
| MR206846 | Actl6a (Myc-DDK-tagged) - Mouse actin-like 6A (Actl6a) |
CNY 3656.00 |
|
| MR206846L3 | Lenti ORF clone of Actl6a (Myc-DDK-tagged) - Mouse actin-like 6A (Actl6a) |
CNY 5230.00 |
|
| MR206846L4 | Lenti ORF clone of Actl6a (mGFP-tagged) - Mouse actin-like 6A (Actl6a) |
CNY 5230.00 |
