Litaf (NM_019980) Mouse Untagged Clone
CAT#: MC207534
Litaf (untagged) - Mouse LPS-induced TN factor (Litaf), (10ug)
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 3222402J11Rik; C85531; N4WBP3; TBX1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC207534 representing NM_019980
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTCGGCTCCAGGACCTTACCAAGCAGCTGCAGGCCCTTCAGTAGTGCCCACCGCACCCCCAACCTATG AAGAAACAGTGGGTGTCAACAGTTACTACCCAACGCCCCCAGCACCTATGCCGGGACCAGCCACAGGGCT CATTACAGGCCCAGATGGGAAGGGAATGAATCCACCTTCGTACTACACCCAGCCTGTGCCTGTCCCCAAC GCCAACGCAATTGCCGTGCAGACCGTTTATGTGCAGCAGCCTGTCTCCTTCTATGACCGCCCCGTCCAGA TGTGCTGTCCTTCCTGCAGCAAGATGATCGTGACCCAGCTGTCCTACAATGCGGGAGCCCTCACCTGGCT CTCCTGTGGCAGTCTGTGTCTGCTGGGATGCGTTGCTGGCTGCTGCTTCATCCCGTTCTGCGTAGACGCC CTACAGGATGTGGACCACTACTGCCCCAACTGCAAAGCGCTCCTGGGCACCTACAAGCGCTTGTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_019980 |
Insert Size | 486 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_019980.2, NP_064364.1 |
RefSeq Size | 2240 bp |
RefSeq ORF | 486 bp |
Locus ID | 56722 |
UniProt ID | Q9JLJ0 |
Gene Summary | Plays a role in endosomal protein trafficking and in targeting proteins for lysosomal degradation. Plays a role in targeting endocytosed EGFR and ERGG3 for lysosomal degradation, and thereby helps downregulate downstream signaling cascades (PubMed:23166352). Helps recruit the ESCRT complex components TSG101, HGS and STAM to cytoplasmic membranes. Probably plays a role in regulating protein degradation via its interaction with NEDD4 (By similarity). May also contribute to the regulation of gene expression in the nucleus. Binds DNA (in vitro) and may play a synergistic role with STAT6 in the nucleus in regulating the expression of various cytokines (PubMed:15793005, PubMed:21980379). May regulate the expression of numerous cytokines, such as TNF, CCL2, CCL5, CXCL1, IL1A and IL10 (PubMed:12355436, PubMed:15025820, PubMed:16954198, PubMed:21980379, PubMed:22160695).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG201259 | Litaf (tGFP-tagged) - Mouse LPS-induced TN factor (Litaf) |
CNY 2850.00 |
|
MR201259 | Litaf (Myc-DDK-tagged) - Mouse LPS-induced TN factor (Litaf) |
CNY 1200.00 |
|
MR201259L3 | Lenti ORF clone of Litaf (Myc-DDK-tagged) - Mouse LPS-induced TN factor (Litaf) |
CNY 4750.00 |
|
MR201259L4 | Lenti ORF clone of Litaf (mGFP-tagged) - Mouse LPS-induced TN factor (Litaf) |
CNY 4750.00 |