Ppih (NM_028677) Mouse Untagged Clone
CAT#: MC207560
Ppih (untagged) - Mouse peptidyl prolyl isomerase H (Ppih), transcript variant 1, (10ug)
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 1100001J08Rik; 2010111B15Rik; 4833408F11Rik; AI464484; CYP-20; CYPH; D4Wsu43e |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC207560 representing NM_028677
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCGGTGGCAAATTCAAGTCCAGTCAATCCAGTGGTCTTCTTCGATGTCAGCATTGGCGGCCAGGAAG TTGGTCGCATGAAAATCGAGCTCTTTGCAGACGTGGTGCCTAAGACGGCAGAGAACTTTAGGCAATTCTG CACCGGAGAGTTCAGAAAAGATGGCGTTCCGATAGGATACAAAGGAAGCACCTTCCACAGGGTCATAAAG GATTTCATGATTCAGGGTGGAGATTTTGTTAATGGCGATGGCACTGGAGTCGCCAGTATTTACCGGGGTC CATTTGCGGATGAAAATTTTAAACTTAGACACTCTGCTCCAGGCCTGCTTTCCATGGCAAACAGTGGTCC CAGTACAAATGGCTGCCAGTTCTTTATCACGTGTTCTAAGTGTGATTGGCTGGATGGAAAGCATGTAGTG TTTGGAAAAATCATTGACGGACTTCTAGTGATGAGGAAGATCGAGAATGTTCCCACAGGCCCCAACAATA AGCCCAAACTGCCAGTGGTGATCTCACAGTGTGGGGAAATGTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_028677 |
| Insert Size | 534 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_028677.4, NP_082953.1 |
| RefSeq Size | 795 bp |
| RefSeq ORF | 534 bp |
| Locus ID | 66101 |
| UniProt ID | Q9D868 |
| Gene Summary | PPIase that catalyzes the cis-trans isomerization of proline imidic peptide bonds in oligopeptides and may therefore assist protein folding. Participates in pre-mRNA splicing. May play a role in the assembly of the U4/U5/U6 tri-snRNP complex, one of the building blocks of the spliceosome. May act as a chaperone.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the most predominant transcript. Transcript variants 1 and 2 encode the same isoform (1). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG201558 | Ppih (tGFP-tagged) - Mouse peptidyl prolyl isomerase H (Ppih) |
CNY 2850.00 |
|
| MR201558 | Ppih (Myc-DDK-tagged) - Mouse peptidyl prolyl isomerase H (Ppih), transcript variant 1 |
CNY 2400.00 |
|
| MR201558L3 | Lenti ORF clone of Ppih (Myc-DDK-tagged) - Mouse peptidyl prolyl isomerase H (Ppih), transcript variant 1 |
CNY 4750.00 |
|
| MR201558L4 | Lenti ORF clone of Ppih (mGFP-tagged) - Mouse peptidyl prolyl isomerase H (Ppih), transcript variant 1 |
CNY 4750.00 |
