Chmp1b (NM_024190) Mouse Untagged Clone
CAT#: MC207606
Chmp1b (untagged) - Mouse chromatin modifying protein 1B (Chmp1b), (10ug)
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 2810405I11Rik; Chmp1b1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC207606 representing NM_024190
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTCCAACATGGAGAAGCATCTGTTCAACCTGAAATTCGCGGCCAAAGAACTGAACCGGAGTTCCAAAA AATGCGACAAGGAAGAAAAGGCCGAAAAGGCCAAAATTAAAAAGGCCATTCAGAAGGGCAACATGGAAGT TGCGAGGATTCACGCCGAAAATGCCATCCGCCAGAAGAATCAAGGGGTGAACTTCTTGAGAATGAGTGCA CGAGTGGATGCGGTGGCGGCCCGTGTCCAGACTGCAGTGACGATGGGCAAAGTGACCAAGTCCATGGCGG GTGTGGTTAAGTCGATGGACGCGACGTTGAAAAGTATGAATCTGGAGAAGATCTCCGCTTTGATGGACAA ATTCGAACACCAGTTCGAGACTCTGGACGTCCAGACGCAGCAAATGGAAGACACAATGAGCAGCACGACG ACGCTGACCACTCCCCAGAACCAGGTGGATATGCTGCTCCAGGAAATGGCAGATGAGGCGGGCCTCGATC TCAACATGGAGCTGCCTCAGGGCCAGACCGGTTCCGTGGGAACGAGCGTGGCTTCGGCTGAGCAAGATGA ACTGTCCCAGAGACTGGCCCGCCTTCGGGATCAAGTCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_024190 |
Insert Size | 600 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_024190.2, NP_077152.1 |
RefSeq Size | 2529 bp |
RefSeq ORF | 600 bp |
Locus ID | 67064 |
UniProt ID | Q99LU0 |
Gene Summary | Probable peripherally associated component of the endosomal sorting required for transport complex III (ESCRT-III) which is involved in multivesicular bodies (MVBs) formation and sorting of endosomal cargo proteins into MVBs. MVBs contain intraluminal vesicles (ILVs) that are generated by invagination and scission from the limiting membrane of the endosome and mostly are delivered to lysosomes enabling degradation of membrane proteins, such as stimulated growth factor receptors, lysosomal enzymes and lipids. The MVB pathway appears to require the sequential function of ESCRT-O, -I,-II and -III complexes. ESCRT-III proteins mostly dissociate from the invaginating membrane before the ILV is released. The ESCRT machinery also functions in topologically equivalent membrane fission events, such as the terminal stages of cytokinesis. ESCRT-III proteins are believed to mediate the necessary vesicle extrusion and/or membrane fission activities, possibly in conjunction with the AAA ATPase VPS4. Involved in cytokinesis. Involved in recruiting VPS4A and/or VPS4B and SPAST to the midbody of dividing cells (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG202011 | Chmp1b (tGFP-tagged) - Mouse chromatin modifying protein 1B (Chmp1b) |
CNY 2850.00 |
|
MR202011 | Chmp1b (Myc-DDK-tagged) - Mouse chromatin modifying protein 1B (Chmp1b) |
CNY 2400.00 |
|
MR202011L3 | Lenti ORF clone of Chmp1b (Myc-DDK-tagged) - Mouse chromatin modifying protein 1B (Chmp1b) |
CNY 4750.00 |
|
MR202011L4 | Lenti ORF clone of Chmp1b (mGFP-tagged) - Mouse chromatin modifying protein 1B (Chmp1b) |
CNY 4750.00 |