Ppif (NM_134084) Mouse Untagged Clone
CAT#: MC207815
Ppif (untagged) - Mouse peptidylprolyl isomerase F (cyclophilin F) (Ppif), nuclear gene encoding mitochondrial protein, (10ug)
CNY 2400.00
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | AW457192; CyP-D; CyP-F; CypD; PPIase |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC207815 representing NM_134084
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCTAGCGCTGCGTTGCGGCCCCCGCCTGCTCGGTCTGCTCTCCGGCCCGCGCTCCGCGCCGCTGCTCC TCTCCGCGACCCGTACCTGCAGCGACGGCGGAGCCCGCGGCGCGAACTCTTCCTCCGGGAACCCGCTCGT GTACTTGGACGTGGGCGCCGATGGACAGCCGCTCGGCCGCGTGGTGCTGGAGTTAAAGGCAGATGTCGTG CCAAAGACTGCAGAGAACTTCAGAGCCCTATGCACTGGTGAGAAGGGCTTTGGCTACAAAGGCTCCACCT TCCACAGGGTGATCCCAGCCTTCATGTGCCAGGCTGGCGACTTCACCAACCACAATGGCACAGGAGGGAG GTCCATCTACGGAAGCCGCTTTCCCGACGAGAACTTCACACTGAAGCATGTGGGGCCAGGTGTCCTGTCC ATGGCGAACGCAGGCCCCAACACCAATGGCTCTCAGTTCTTTATCTGCACGATAAAGACAGACTGGCTAG ATGGCAAGCATGTCGTGTTCGGCCATGTCAAAGAGGGCATGGATGTTGTGAAGAAAATAGAATCTTTCGG CTCAAAAAGTGGGAAGACGTCTAAGAAGATTGTCATCACAGACTGTGGCCAGTTGAGCTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_134084 |
Insert Size | 621 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_134084.1, NP_598845.1 |
RefSeq Size | 1560 bp |
RefSeq ORF | 621 bp |
Locus ID | 105675 |
UniProt ID | Q99KR7 |
Gene Summary | PPIase that catalyzes the cis-trans isomerization of proline imidic peptide bonds in oligopeptides and may therefore assist protein folding. Involved in regulation of the mitochondrial permeability transition pore (mPTP). It is proposed that its association with the mPTP is masking a binding site for inhibiting inorganic phosphate (Pi) and promotes the open probability of the mPTP leading to apoptosis or necrosis; the requirement of the PPIase activity for this function is debated. In cooperation with mitochondrial TP53 is involved in activating oxidative stress-induced necrosis. Involved in modulation of mitochondrial membrane F(1)F(0) ATP synthase activity and regulation of mitochondrial matrix adenine nucleotide levels. Has anti-apoptotic activity independently of mPTP and in cooperation with BCL2 inhibits cytochrome c-dependent apoptosis.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG202183 | Ppif (tGFP-tagged) - Mouse peptidylprolyl isomerase F (cyclophilin F) (Ppif) |
CNY 2850.00 |
|
MR202183 | Ppif (Myc-DDK-tagged) - Mouse peptidylprolyl isomerase F (cyclophilin F) (Ppif), nuclear gene encoding mitochondrial protein |
CNY 2400.00 |
|
MR202183L3 | Lenti ORF clone of Ppif (Myc-DDK-tagged) - Mouse peptidylprolyl isomerase F (cyclophilin F) (Ppif), nuclear gene encoding mitochondrial protein |
CNY 4750.00 |
|
MR202183L4 | Lenti ORF clone of Ppif (mGFP-tagged) - Mouse peptidylprolyl isomerase F (cyclophilin F) (Ppif), nuclear gene encoding mitochondrial protein |
CNY 4750.00 |