Srsf1 (NM_173374) Mouse Untagged Clone
CAT#: MC207837
Srsf1 (untagged) - Mouse serine/arginine-rich splicing factor 1 (Srsf1), transcript variant 1, (10ug)
CNY 3990.00
Product images
                    
                Specifications
| Product Data | |
| Type | Mouse Untagged Clone | 
| Tag | Tag Free | 
| Synonyms | 1110054N12Rik; 5730507C05Rik; 6330415C05Rik; AI482334; Asf; AW491331; Sf; Sf2; Sfrs1 | 
| Vector | pCMV6-Entry | 
| E. coli Selection | Kanamycin (25 ug/mL) | 
| Mammalian Cell Selection | Neomycin | 
| Sequence Data | 
                
                
                
                 >MC207837 representing NM_173374 
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTCGGGAGGTGGTGTGATCCGTGGCCCGGCGGGGAACAACGACTGCCGCATCTACGTGGGTAACCTAC CTCCGGATATCCGAACCAAGGACATCGAGGACGTGTTTTACAAATACGGCGCCATCCGCGACATCGACCT GAAGAACCGCCGCGGGGGACCGCCCTTCGCCTTCGTTGAGTTCGAGGACCCGCGAGACGCGGAAGATGCG GTGTACGGTCGCGACGGCTACGACTACGACGGCTACCGGCTGCGGGTAGAGTTTCCCCGAAGCGGCCGCG GGACCGGCCGAGGCGGCGGCGGGGGTGGAGGCGGCGGCGCCCCGAGAGGCCGCTATGGCCCGCCGTCCAG GCGGTCCGAGAACAGAGTGGTTGTCTCTGGACTGCCTCCGAGTGGAAGCTGGCAGGACTTAAAGGATCAC ATGCGTGAGGCAGGTGATGTATGTTACGCTGATGTTTACCGAGATGGCACTGGTGTCGTGGAGTTTGTAC GGAAAGAAGATATGACGTATGCAGTTCGAAAACTGGATAACACTAAGTTTAGATCTCACGAGGGAGAAAC TGCCTACATCCGGGTTAAAGTTGATGGGCCCAGAAGTCCAAGTTATGGAAGATCTCGATCTCGAAGCCGT AGTCGTAGCAGAAGCCGTAGCAGAAGCAACAGCAGGAGTCGCAGTTACTCCCCAAGGAGAAGCAGAGGAT CACCACGCTATTCTCCCCGTCATAGCAGATCTCGCTCTCGTACATAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA  | 
        
| Restriction Sites | SgfI-MluI | 
| ACCN | NM_173374 | 
| Insert Size | 747 bp | 
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info  | 
        
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). | 
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.  | 
        
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. | 
| Reference Data | |
| RefSeq | NM_173374.4, NP_775550.2 | 
| RefSeq Size | 5364 bp | 
| RefSeq ORF | 747 bp | 
| Locus ID | 110809 | 
| UniProt ID | Q6PDM2 | 
| Gene Summary | The protein encoded by this gene is a member of the serine/arginine (SR)-rich family of pre-mRNA splicing factors, which constitute part of the spliceosome. Each of these factors contains an RNA recognition motif (RRM) for binding RNA and an RS domain for binding other proteins. The RS domain is rich in serine and arginine residues and facilitates interaction between different SR splicing factors. In addition to being critical for mRNA splicing, the SR proteins have also been shown to be involved in mRNA export from the nucleus and in translation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2010] Transcript Variant: This variant (1) encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.  | 
        
Documents
| Product Manuals | 
| FAQs | 
| SDS | 
Resources
Other Versions
| SKU | Description | Size | Price | 
|---|---|---|---|
| MG203152 | Srsf1 (tGFP-tagged) - Mouse splicing factor, arginine/serine-rich 1 (ASF/SF2) (Sfrs1), transcript variant 1 | 
                                                     CNY 4370.00  | 
                                            |
| MR203152 | Srsf1 (Myc-DDK-tagged) - Mouse serine/arginine-rich splicing factor 1 (Srsf1), transcript variant 1 | 
                                                     CNY 3600.00  | 
                                            |
| MR203152L1 | Lenti ORF clone of Srsf1 (Myc-DDK-tagged) - Mouse serine/arginine-rich splicing factor 1 (Srsf1), transcript variant 1 | 
                                                     CNY 5890.00  | 
                                            |
| MR203152L2 | Lenti ORF clone of Srsf1 (mGFP-tagged) - Mouse serine/arginine-rich splicing factor 1 (Srsf1), transcript variant 1 | 
                                                     CNY 6000.00  | 
                                            |
| MR203152L3 | Lenti ORF clone of Srsf1 (Myc-DDK-tagged) - Mouse serine/arginine-rich splicing factor 1 (Srsf1), transcript variant 1 | 
                                                     CNY 5890.00  | 
                                            |
| MR203152L4 | Lenti ORF clone of Srsf1 (mGFP-tagged) - Mouse serine/arginine-rich splicing factor 1 (Srsf1), transcript variant 1 | 
                                                     CNY 5890.00  | 
                                            
