Tifa (NM_145133) Mouse Untagged Clone
CAT#: MC207861
Tifa (untagged) - Mouse TRAF-interacting protein with forkhead-associated domain (Tifa), (10ug)
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | T2bp |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC207861 representing NM_145133
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTCCACCTTTGAAGACGCTGATACAGAGGAGACGGTCACTTGTCTCCAGATGACCATTTACCATCCTG GCCAACAAAGTGGGATATTTAAATCAATAAGGTTTTGCAGCAAAGAGAAGTTTCCTTCCATTGAAGTGGT GAAATTTGGACGCAATTCCAACATGTGCCAGTATACGTTTCAGGACAAACAGGTGTCCCGAATTCAGTTT GTTTTACAGCCGTTTAAACAGTTCAACAGCTCCGTTCTCTCGTTTGAAATAAAAAACATGAGCAAGAAAA CCAGTTTGATGGTAGACAACCAGGAGCTCGGCTACCTCAATAAAATGGACCTGCCTTACAAGTGTATGCT CAGGTTCGGAGAGTATCAGTTCCTGTTGCAGAAGGAAGACGGAGAGTCGGTGGAATCTTTTGAGACTCAA TTTATCATGTCTTCAAGACCTCTCTTGCAAGAAAACAACTGGCCAACACAGAATCCCATACCAGAGGATG GGATGTATTCTTCATACTTCACCCACAGAAGTTCTCCTTCAGAAATGGATGAAAACGAACTGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_145133 |
| Insert Size | 555 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_145133.3, NP_660115.1 |
| RefSeq Size | 2164 bp |
| RefSeq ORF | 555 bp |
| Locus ID | 211550 |
| UniProt ID | Q793I8 |
| Gene Summary | Adapter molecule that plays a key role in the activation of proinflammatory NF-kappa-B signaling following detection of bacterial pathogen-associated molecular pattern metabolites (PAMPs) (PubMed:11798190). Promotes activation of an innate immune response by inducing the oligomerization and polyubiquitination of TRAF6, which leads to the activation of TAK1 and IKK through a proteasome-independent mechanism (By similarity). TIFA-dependent innate immune response is triggered by ADP-D-glycero-beta-D-manno-heptose (ADP-Heptose), a potent PAMP present in all Gram-negative and some Gram-positive bacteria: ADP-Heptose is recognized by ALPK1, which phosphorylates TIFA at Thr-9, leading to TIFA homooligomerization and subsequent activation of proinflammatory NF-kappa-B signaling (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG201692 | Tifa (tGFP-tagged) - Mouse Traf2 binding protein (T2bp) |
CNY 2850.00 |
|
| MR201692 | Tifa (Myc-DDK-tagged) - Mouse TRAF-interacting protein with forkhead-associated domain (Tifa) |
CNY 2400.00 |
|
| MR201692L3 | Lenti ORF clone of Tifa (Myc-DDK-tagged) - Mouse TRAF-interacting protein with forkhead-associated domain (Tifa) |
CNY 4750.00 |
|
| MR201692L4 | Lenti ORF clone of Tifa (mGFP-tagged) - Mouse TRAF-interacting protein with forkhead-associated domain (Tifa) |
CNY 4750.00 |
