Cidec (NM_178373) Mouse Untagged Clone
CAT#: MC208012
Cidec (untagged) - Mouse cell death-inducing DFFA-like effector c (Cidec), (10ug)
CNY 3600.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | CIDE-3; Fsp27 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC208012 representing NM_178373
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGACTATGCCATGAAGTCTCTCAGCCTCCTGTACCCCAGGTCGCTGTCCAGGCATGTGGCAGTGAGCA CGGCAGTGGTGACCCAACAGCTGGTGTCTAAGCCCAGCCGGGAGACCCCGAGGGCCAGGCCCTGTCGTGT TAGCACCGCAGATCGGAAGGTTCGCAAAGGCATCATGGCTCACAGCTTGGAGGACCTCCTGAACAAGGTC CAGGACATCTTGAAACTTAAAGACAAGCCCTTCTCCCTGGTGCTGGAGGAAGATGGCACAATCGTGGAGA CAGAAGAATACTTCCAAGCCCTGGCAAAAGATACCATGTTCATGGTCCTGCTGAAGGGGCAGAAGTGGAA GCCCCCATCAGAACAGCGCAAGAAGAGAGCCCAGCTAGCCCTTTCCCAGAAGCCAACTAAGAAGATCGAT GTGGCCCGGGTAACCTTCGACCTGTACAAGCTGAACCCTCAGGACTTTATTGGCTGCCTGAACGTGAAGG CAACCCTCTATGACACATACTCGCTTTCCTATGACCTGCACTGCTACAAGGCCAAGCGCATCGTGAAGGA GATGCTCCGCTGGACCCTCTTCAGCATGCAGGCCACCGGTCACATGCTGCTTGGCACCTCCAGCTACATG CAGCAGTTCCTGGATGCCACCGAGGAAGAACAGCCTGCCAAGGCCAAGCCCTCCTCCCTCCTCCCAGCCT GTCTGAAGATGCTGCAATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Chromatograms |
CHROMATOGRAMS
![]() Sequencher program is needed, download here. |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_178373 |
| Insert Size | 720 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC099676, AAH99676 |
| RefSeq Size | 1702 bp |
| RefSeq ORF | 720 bp |
| Locus ID | 14311 |
| UniProt ID | P56198 |
| Gene Summary | Binds to lipid droplets and regulates their enlargement, thereby restricting lipolysis and favoring storage. At focal contact sites between lipid droplets, promotes directional net neutral lipid transfer from the smaller to larger lipid droplets. The transfer direction may be driven by the internal pressure difference between the contacting lipid droplet pair. Its role in neutral lipid transfer and lipid droplet enlargement is activated by the interaction with PLIN1. May act as a CEBPB coactivator in the white adipose tissue to control the expression of a subset of CEBPB downstream target genes, including SOCS1, SOCS3, TGFB1, TGFBR1, ID2 and XDH. When overexpressed in preadipocytes, induces apoptosis or increases cell susceptibility to apoptosis induced by serum deprivation or TGFB treatment. As mature adipocytes, that express high CIDEC levels, are quite resistant to apoptotic stimuli, the physiological significance of its role in apoptosis is unclear. May play a role in the modulation of the response to osmotic stress by preventing NFAT5 to translocate into the nucleus and activate its target genes expression.[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG202932 | Cidec (tGFP-tagged) - Mouse cell death-inducing DFFA-like effector c (Cidec) |
CNY 2660.00 |
|
| MR202932 | Cidec (Myc-DDK-tagged) - Mouse cell death-inducing DFFA-like effector c (Cidec) |
CNY 3600.00 |
|
| MR202932L3 | Lenti ORF clone of Cidec (Myc-DDK-tagged) - Mouse cell death-inducing DFFA-like effector c (Cidec) |
CNY 4280.00 |
|
| MR202932L4 | Lenti ORF clone of Cidec (mGFP-tagged) - Mouse cell death-inducing DFFA-like effector c (Cidec) |
CNY 4280.00 |

