Gdf15 (NM_011819) Mouse Untagged Clone

CAT#: MC208053

Gdf15 (untagged) - Mouse growth differentiation factor 15 (Gdf15), (10ug)



  "NM_011819" in other vectors (4)

CNY 2,400.00

CNY 3,990.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit polyclonal anti-Nag-1 antibody
    • 100 ug

CNY 8,025.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms MIC-; MIC-1; NAG; NAG-1; SBF
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208053 representing NM_011819
Red=Cloning site Blue=ORF

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCCCCGCCCGCGCTCCAGGCCCAGCCTCCAGGCGGCTCTCAACTGAGGTTCCTGCTGTTCCTGCTGC
TGTTGCTGCTGCTGCTGTCATGGCCATCGCAGGGGGACGCCCTGGCAATGCCTGAACAGCGACCCTCCGG
CCCTGAGTCCCAACTCAACGCCGACGAGCTACGGGGTCGCTTCCAGGACCTGCTGAGCCGGCTGCATGCC
AACCAGAGCCGAGAGGACTCGAACTCAGAACCAAGTCCTGACCCAGCTGTCCGGATACTCAGTCCAGAGG
TGAGATTGGGGTCCCACGGCCAGCTGCTACTCCGCGTCAACCGGGCGTCGCTGAGTCAGGGTCTCCCCGA
AGCCTACCGCGTGCACCGAGCGCTGCTCCTGCTGACGCCGACGGCCCGCCCCTGGGACATCACTAGGCCC
CTGAAGCGTGCGCTCAGCCTCCGGGGACCCCGTGCTCCCGCATTACGCCTGCGCCTGACGCCGCCTCCGG
ACCTGGCTATGCTGCCCTCTGGCGGCACGCAGCTGGAACTGCGCTTACGGGTAGCCGCCGGCAGGGGGCG
CCGAAGCGCGCATGCGCACCCAAGAGACTCGTGCCCACTGGGTCCAGGGCGCTGCTGTCACTTGGAGACT
GTGCAGGCAACTCTTGAAGACTTGGGCTGGAGCGACTGGGTGCTGTCCCCGCGCCAGCTGCAGCTGAGCA
TGTGCGTGGGCGAGTGTCCCCACCTGTATCGCTCCGCGAACACGCATGCGCAGATCAAAGCACGCCTGCA
TGGCCTGCAGCCTGACAAGGTGCCTGCCCCGTGCTGTGTCCCCTCCAGCTACACCCCGGTGGTTCTTATG
CACAGGACAGACAGTGGTGTGTCACTGCAGACTTATGATGACCTGGTGGCCCGGGGCTGCCACTGCGCTT
GA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_011819
Insert Size 912 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC067248, AAH67248
RefSeq Size 1104 bp
RefSeq ORF 912 bp
Locus ID 23886
UniProt ID Q9Z0J7
Gene Summary This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. The protein is expressed in a broad range of cell types, acts as a pleiotropic cytokine and is involved in the stress response program of cells after cellular injury. Increased protein levels are associated with disease states such as tissue hypoxia, inflammation, acute injury and oxidative stress. Mice lacking a functional copy of this gene exhibit progressive loss of motor neurons, and more rapid blood clot formation. [provided by RefSeq, Aug 2016]
Transcript Variant: This variant (1) represents the longer transcript. Both variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...