Apod (NM_007470) Mouse Untagged Clone
CAT#: MC208138
Apod (untagged) - Mouse apolipoprotein D (Apod), (10ug)
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC208138 representing NM_007470
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGTGACCATGCTGATGTTCCTGGCCACGCTGGCGGGTCTCTTCACCACAGCCAAAGGACAAAATTTCC ATCTTGGGAAATGCCCGTCTCCTCCTGTGCAAGAGAATTTTGACGTGAAAAAGTATCTTGGAAGATGGTA CGAAATTGAGAAGATCCCAGCGAGCTTTGAGAAAGGAAACTGCATTCAAGCCAACTACTCGCTGATGGAG AACGGAAACATCGAAGTGCTAAACAAGGAGCTGAGTCCTGATGGAACCATGAACCAAGTAAAGGGTGAAG CCAAACAGAGCAACGTCTCAGAGCCAGCCAAGCTGGAAGTCCAGTTCTTCCCGTTGATGCCACCGGCACC CTACTGGATCCTGGCCACCGATTATGAAAACTATGCCCTCGTGTACTCCTGCACCACCTTCTTCTGGCTC TTCCATGTGGATTTTGTTTGGATTCTTGGAAGAAATCCTTATCTCCCTCCAGAAACAATAACCTACCTAA AAGATATCCTTACTTCTAATGGCATCGACATCGAAAAAATGACAACAACAGATCAAGCGAACTGCCCGGA CTTCCTGTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_007470 |
| Insert Size | 570 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_007470.4, NP_031496.2 |
| RefSeq Size | 2074 bp |
| RefSeq ORF | 570 bp |
| Locus ID | 11815 |
| UniProt ID | P51910 |
| Gene Summary | The protein encoded by this gene is a component of high-density lipoprotein (HDL), but is unique in that it shares greater structural similarity to lipocalin than to other members of the apolipoprotein family, and has a wider tissue expression pattern. The encoded protein is involved in lipid metabolism, and ablation of this gene results in defects in triglyceride metabolism. Elevated levels of this gene product have been observed in multiple tissues of Niemann-Pick disease mouse models, as well as in some tumors. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2014] Transcript Variant: This variant (1) represents the longest transcript. Variants 1, 2, and 3 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG227214 | Apod (tGFP-tagged) - Mouse apolipoprotein D (Apod), (10ug) |
CNY 2850.00 |
|
| MR227214 | Apod (Myc-DDK-tagged) - Mouse apolipoprotein D (Apod) |
CNY 2400.00 |
|
| MR227214L3 | Lenti ORF clone of Apod (Myc-DDK-tagged) - Mouse apolipoprotein D (Apod) |
CNY 4750.00 |
|
| MR227214L4 | Lenti ORF clone of Apod (mGFP-tagged) - Mouse apolipoprotein D (Apod) |
CNY 4750.00 |
