Socs1 (NM_009896) Mouse Untagged Clone
CAT#: MC208285
Socs1 (untagged) - Mouse suppressor of cytokine signaling 1 (Socs1), (10ug)
CNY 2400.00
CNY 3990.00
Product images
                    
                Specifications
| Product Data | |
| Type | Mouse Untagged Clone | 
| Tag | Tag Free | 
| Synonyms | Cish1; Cish7; JAB; SOCS-1; SSI-1 | 
| Vector | pCMV6-Entry | 
| E. coli Selection | Kanamycin (25 ug/mL) | 
| Mammalian Cell Selection | Neomycin | 
| Sequence Data | 
                
                
                
                 >MC208285 representing NM_009896 
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGTAGCACGCAACCAGGTGGCAGCCGACAATGCGATCTCCCCGGCAGCAGAGCCCCGACGGCGGTCAG AGCCCTCCTCGTCCTCGTCTTCGTCCTCGCCAGCGGCCCCCGTGCGTCCCCGGCCCTGCCCGGCGGTCCC AGCCCCAGCCCCTGGCGACACTCACTTCCGCACCTTCCGCTCCCACTCCGATTACCGGCGCATCACGCGG ACCAGCGCGCTCCTGGACGCCTGCGGCTTCTATTGGGGACCCCTGAGCGTGCACGGGGCGCACGAGCGGC TGCGTGCCGAGCCCGTGGGCACCTTCTTGGTGCGCGACAGTCGCCAACGGAACTGCTTCTTCGCGCTCAG CGTGAAGATGGCTTCGGGCCCCACGAGCATCCGCGTGCACTTCCAGGCCGGCCGCTTCCACTTGGACGGC AGCCGCGAGACCTTCGACTGCCTTTTCGAGCTGCTGGAGCACTACGTGGCGGCGCCGCGCCGCATGTTGG GGGCCCCGCTGCGCCAGCGCCGCGTGCGGCCGCTGCAGGAGCTGTGTCGCCAGCGCATCGTGGCCGCCGT GGGTCGCGAGAACCTGGCGCGCATCCCTCTTAACCCGGTACTCCGTGACTACCTGAGTTCCTTCCCCTTC CAGATCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA  | 
        
| Chromatograms | 
                CHROMATOGRAMS
                ![]() Sequencher program is needed, download here.  | 
        
| Restriction Sites | SgfI-MluI | 
| ACCN | NM_009896 | 
| Insert Size | 639 bp | 
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). | 
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). | 
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.  | 
        
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. | 
| Reference Data | |
| RefSeq | NM_009896.2, NP_034026.1 | 
| RefSeq Size | 1220 bp | 
| RefSeq ORF | 639 bp | 
| Locus ID | 12703 | 
| UniProt ID | O35716 | 
| Gene Summary | SOCS family proteins form part of a classical negative feedback system that regulates cytokine signal transduction. SOCS1 is involved in negative regulation of cytokines that signal through the JAK/STAT3 pathway. Through binding to JAKs, inhibits their kinase activity. In vitro, also suppresses Tec protein-tyrosine activity (By similarity). Appears to be a major regulator of signaling by interleukin 6 (IL6) and leukemia inhibitory factor (LIF). Regulates interferon-gamma mediated sensory neuron survival. Probable substrate recognition component of an ECS (Elongin BC-CUL2/5-SOCS-box protein) E3 ubiquitin-protein ligase complex which mediates the ubiquitination and subsequent proteasomal degradation of target proteins. Seems to recognize JAK2 (By similarity). SOCS1 appears to be a negative regulator in IGF1R signaling pathway (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Both variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.  | 
        
Documents
| Product Manuals | 
| FAQs | 
| SDS | 
Resources
Other Versions
| SKU | Description | Size | Price | 
|---|---|---|---|
| MG226604 | Socs1 (tGFP-tagged) - Mouse suppressor of cytokine signaling 1 (Socs1), (10ug) | 
                                                     CNY 4000.00  | 
                                            |
| MR226604 | Socs1 (Myc-DDK-tagged) - Mouse suppressor of cytokine signaling 1 (Socs1) | 
                                                     CNY 2400.00  | 
                                            |
| MR226604L3 | Lenti ORF clone of Socs1 (Myc-DDK-tagged) - Mouse suppressor of cytokine signaling 1 (Socs1) | 
                                                     CNY 4750.00  | 
                                            |
| MR226604L4 | Lenti ORF clone of Socs1 (mGFP-tagged) - Mouse suppressor of cytokine signaling 1 (Socs1) | 
                                                     CNY 4800.00  | 
                                            

