Crem (NM_013498) Mouse Untagged Clone
CAT#: MC208322
Crem (untagged) - Mouse cAMP responsive element modulator (Crem), transcript variant 3, (10ug)
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | IC; ICER; ICERI |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC208322 representing NM_013498
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAGCAAATGTGGCAGGAAAAAGTATATGAGGACAAATGTAAGGCAAATGACCATGGAAACAGTTGAAT CACAGCAGGATCGAAGTGTAACACGTTCTGTGGCAGAGCATAGCTCTGCTCATATGCAGACTGGTCAAAT TTCTGTTCCTACTCTAGCTCAGGTAGCAACAATTGCAGAGACAGATGATTCTGCAGACTCAGAAGTAATT GATTCGCATAAACGTAGAGAAATTCTTTCACGAAGACCCTCATATAGAAAAATACTGAATGAACTTTCCT CTGATGTGCCTGGTATTCCCAAGATTGAAGAAGAAAAATCAGAGGAAGAAGGGACACCACCTAACATTGC TACCATGGCAGTACCAACTAGCATATATCAGACTAGCACGGGGCAATACAATGAGGAGACTGACCTTGCC CCAAGTCACATGGCTGCTGCCACAGGTGACATGCCAACTTACCAGATCCGAGCTCCTACTACTGCTTTGC CACAAGGTGTGGTGATGGCTGCCTCACCAGGAAGCCTGCACAGTCCCCAGCAACTAGCAGAAGAAGCAAC TCGCAAGCGGGAGCTGAGGCTGATGAAAAACAGGGAAGCTGCCCGGGAGTGTCGCAGGAAGAAGAAAGAA TATGTCAAATGTCTTGAAAATCGTGTGGCTGTGCTTGAAAATCAAAACAAGACCCTCATTGAGGAACTCA AGGCCCTCAAAGACCTTTATTGCCATAAAGCAGAGTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_013498 |
Insert Size | 738 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_013498.3, NP_038526.2 |
RefSeq Size | 2423 bp |
RefSeq ORF | 738 bp |
Locus ID | 12916 |
UniProt ID | P27699 |
Gene Summary | This gene encodes a basic-leucine zipper domain-containing protein that localizes to gene promoters, where it binds to the cyclic AMP response element (CRE). Different protein isoforms encoded by this gene may function as either activators or repressors of transcription. Activity of this gene is important in multiple developmental processes, including spermatogenesis. Mutation of this gene causes male infertility. Alternative splicing and promoter usage result in multiple transcript variants for this gene. [provided by RefSeq, Oct 2012] Transcript Variant: This variant (3, also known as alpha) lacks two alternate in-frame exons and uses an alternate splice site in the 3' coding region, compared to variant 1. The encoded isoform (3) is shorter and has a distinct C-terminus, compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG222531 | Crem (tGFP-tagged) - Mouse cAMP responsive element modulator (Crem) transcript variant 3, (10ug) |
CNY 2760.00 |
|
MR222531 | Crem (Myc-DDK-tagged) - Mouse cAMP responsive element modulator (Crem), transcript variant 3 |
CNY 2470.00 |
|
MR222531L3 | Lenti ORF clone of Crem (Myc-DDK-tagged) - Mouse cAMP responsive element modulator (Crem), transcript variant 3 |
CNY 4370.00 |
|
MR222531L4 | Lenti ORF clone of Crem (mGFP-tagged) - Mouse cAMP responsive element modulator (Crem), transcript variant 3 |
CNY 4370.00 |