Cryba1 (NM_009965) Mouse Untagged Clone
CAT#: MC208338
Cryba1 (untagged) - Mouse crystallin, beta A1 (Cryba1), (10ug)
CNY 3990.00
Product images
                    
                Specifications
| Product Data | |
| Type | Mouse Untagged Clone | 
| Tag | Tag Free | 
| Synonyms | BA3/; BA3/A1; Cry; Cryb | 
| Vector | pCMV6-Entry | 
| E. coli Selection | Kanamycin (25 ug/mL) | 
| Mammalian Cell Selection | Neomycin | 
| Sequence Data | 
                
                
                
                 >MC208338 representing NM_009965 
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGAGACCCAGACTGTGCAGCGGGAGTTGGAAACTCTTCCAACCACCAAGATGGCTCAGACCAACCCTA TGCCAGGATCCTTGGGGCCATGGAAGATAACCATCTACGATCAAGAGAACTTCCAGGGCAAGAGGATGGA GTTCACCAGCTCCTGCCCAAATGTCTCTGAACGTAATTTTGATAATGTCCGGTCACTTAAGGTGGAGTGT GGCGCCTGGATTGGTTATGAACACACCAGCTTCTGTGGGCAACAGTTCATCCTGGAAAGAGGAGAATACC CTCGATGGGATGCCTGGAGCGGGAGCAATGCCTATCATATTGAGCGTCTCATGTCCTTCCGACCCATCTG TTCCGCTAATCATAAAGAGTCTAAGATTACCATCTTCGAGAAAGAGAACTTTATTGGACGCCAGTGGGAA ATCTGTGATGACTACCCTTCCTTGCAAGCCATGGGTTGGTTCAACAATGAAGTTGGTTCCATGAAGATAC AATGTGGGGCCTGGGTTTGCTACCAGTACCCTGGATATCGTGGTTATCAGTATATCTTGGAGTGTGACCA CCATGGAGGAGACTACAAGCACTGGCCAGAGTGGGGATCTCACGCCCAGACTTCCCAGATCCAATCAATT CGCCGAATACAACAATAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA  | 
        
| Restriction Sites | SgfI-MluI | 
| ACCN | NM_009965 | 
| Insert Size | 648 bp | 
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). | 
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). | 
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.  | 
        
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. | 
| Reference Data | |
| RefSeq | NM_009965.3, NP_034095.1 | 
| RefSeq Size | 819 bp | 
| RefSeq ORF | 648 bp | 
| Locus ID | 12957 | 
| Gene Summary | Mammalian lens crystallins are divided into alpha, beta, and gamma families. Alpha and beta families are further divided into acidic and basic groups. Seven protein regions exist in crystallins: four homologous motifs, a connecting peptide, and N- and C-terminal extensions. Beta-crystallins, the most heterogeneous, differ by the presence of the C-terminal extension (present in the basic group, none in the acidic group). Beta-crystallins form aggregates of different sizes and are able to self-associate to form dimers or to form heterodimers with other beta-crystallins. This gene, a beta acidic group member, encodes two proteins (crystallin, beta A3 and crystallin, beta A1) from a single mRNA. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).  | 
        
Documents
| Product Manuals | 
| FAQs | 
| SDS | 
Resources
Other Versions
| SKU | Description | Size | Price | 
|---|---|---|---|
| MG220494 | Cryba1 (tGFP-tagged) - Mouse crystallin beta A1 (Cryba1), (10ug) | 
                                                     CNY 2850.00  | 
                                            |
| MR220494 | Cryba1 (Myc-DDK-tagged) - Mouse crystallin, beta A1 (Cryba1) | 
                                                     CNY 2400.00  | 
                                            |
| MR220494L3 | Lenti ORF clone of Cryba1 (Myc-DDK-tagged) - Mouse crystallin, beta A1 (Cryba1) | 
                                                     CNY 4750.00  | 
                                            |
| MR220494L4 | Lenti ORF clone of Cryba1 (mGFP-tagged) - Mouse crystallin, beta A1 (Cryba1) | 
                                                     CNY 4750.00  | 
                                            
